[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
이엔셀
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioWave  Vol.25, No.2 (2023년 2월) 오픈
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-DNA > PCR/RT-PCR/Q-PCR
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. qRT-PCR , triplicate(replicate)에 대해서
  안녕하세요. qRT-PCR를 공부하다 의문점이 생겨 질문드립니다. 그림을 보면서 질문 드리는게 빨라 그림을 먼저 제시합니다. (5개의 샘플, 6개의 유전자(5개유전자 +GAPDH))   이 논문에서는 WT(정상인)과 환자4분(FD-1,FD-2,FD-3,FD-4)으로 부터 유래한 세포를 배양하여 qRT-PCR를 진행한 디자인 입니다.  이 논문에서는 qRT-PCR는 triplicate으로 진행했다고 하였으며 SEM(N=3)을 했다고 나와 있습니다.    1. 제가 이해하기로는 1,2,3번 컬럼의 WT이 모두 하나의 세포 배양plate에서 추출한 RNA로 이해했는데 맞나요? 즉 qRT-PCR당 5개의 세포배양을 준비해야하 하고 N=3이니 총 15개의 세포배양을 해야한다 라고 이해했는데 맞나 모르겠습니다. 1번의 경우 (The data are expressed as means +- SEM(n=3).)     2. 사실 위의 개념이 햇갈린 이유는, 다른 논문에서는 triplicate로 qRT-PCR로 진행했다고 하면서 mean+sd 의 그래프를 제시합니다. 이 경우는  1,2,3번 컬럼에서 WT이긴 하지만 하나의 세포배양 plate가 아닌 3개의 서로 다른 plate로 한번에 qRT-PCR진행한것 같습니다 맞나요? 2번의 경우 (Experiments were conducted in triplicate (mean ± SD).)       3. 제가 위에 제시한 개념이 모두 맞다면 1번과 2번 경우 모두 기술적 차이는 없는것 인가요? 2번의 방법으로 제시해도 괜찮은지 그 qPCR 오차에서.. 그런부분이 좀 신경쓰입니다. 물론 실험디자인상 실험가격도 고려해야할 중요한 요소 이지만요    감사합니다.   
회원작성글 대학원지망생  |  02.08
Q. Agarose 전기영동할때 sample이 퍼집니다.
DNA 전기영동하려고 Agarose gel에 로딩하려고 하는데 sample이 가라앉지 않고 TAE buffer안에서 퍼져서 확산됩니다. PCR product는 아니고 mRNA 합성한것 내려본 것입니다. 샘플이 날라가버렸는데 어떤 컨디션이 안맞는걸까요?
회원작성글 nuco  |  02.06
Q. qPCR 전기영동 band dimer 질문입니다.
평소 실험을 할 때 dimer가 50bp 근처에서 생겨났는데  이번 실험에서는 한참 아래쪽에 band가 생겨서요 이게 dimer라고 하기에는 size가 너무 작아서 질문 드립니다.     목표 product는 70bp정도이고 DNA ladder는 50bp 사용했습니다
회원작성글 안일한녹조식물  |  02.06
Q. PCR mixture 제조관련 질문
안녕하세요 궁금한 점이 생겨 이렇게 글을 올립니다.  현재 g사의 PCR KIT를 사용하고 있으며, mixture제조시  buffer, dNTP, DW로만 혼합하여, 분주하여 사용합니다.  제가 궁금한 점은 DW의 경우 Make up을 위해 첨가하는 것이기도하고, DNA의 농도가 각 각 다르기 때문에 Mixture의 분주량이 달라지는데 이럴 경우 buffer, dNTP의 양이 제대로 들어가는지 의문이기에 여쭤봅니다.  물론 사용하기 전에 피펫팅이며, 볼텍싱이며 제대로 섞어주려고 신경은 써줍니다.    
회원작성글 해조칼슘풍덩  |  02.06
Q. PCR primer design 도전 중 고난과 역경..
안녕하세요 최근 PCR을 세팅하고있는 피린이 입니다. 현재 apoptosis 관련된 마커들을 몇가지 확인하고자 primer design을 진행 중 입니다. 여기서 한 가지 궁금한 점이 생겨서 이렇게 질문드리게 되었습니다.  보통 Primer를 짜기 전에 보고자하는 유전자서열을 전체 긁어온뒤 프라이머를 짜고있습니다. 조금 더 구체적으로는 NCBI, UCSC 에서 해당 유전자를 검색하고 타겟 유전자를 불러와 유전자멥을 그려놓습니다. 프라이머를 20-24 mer 정도의 크기로 Tm 값이나 GC%, target gene size 등 확인하며 디자인 진행 중에 있었습니다. 여기서 궁금한 점은 다음과 같습니다. 1) target gene만 인식하는지는 어떤식으로 평가를 하시나요? 2) cleaved form 의 유전자들을 어떻게 디자인을 해야할까요..?? 유전자를 검색해도 cleaved ~~~ 이렇게 검색하면 따로 검색이 되지 않아서 위의 방식으로 디자인을 진행하지 못하고 있습니다..ㅎㅎ.... 여기저기 검색해가며 찾아보려하는데 이렇다할 해답을 얻지 못했습니다ㅠㅠ 물론 다른 논문들을 찾아보면서 해당 primer의 sequence를 얻을 수는 있었습니다만, 저는 제가 직접 짜는 방법을 알고있는 것이 더 좋을거라 생각이 들어 이렇게 질문드립니다.  염치없지만 PCR 고수님들은 보통 어떻게 찾으시는지 도움을 부탁드리겠습니다!!
회원작성글 대하권생  |  02.05
Q. qPCT Tm값
안녕하세요. qPCR을 처음 해본 학부생입니다. qPCR 진행 후 Tm값 결과를 얻었는데, PCR mixture가 약간 부족했던 튜브만 Tm값이 살짝 다른 위치에 나왔는데 Tm값과 PCR mixture volume이 어떤 관계가 있는건지 궁금합니다!! PCR mixture 양이 아주 달랐던건 아닌데 이거 말고는 원인이 없는거 같습니다… 너무 궁금해서 계속 찾아봤는데, 구글링해봐도 잘 모르겠습니다ㅠㅜ 아직 부족한 부분이 너무 많습니다. 너그럽게 이해해주시고, 알려주시면 정말 감사하겠습니다 !!
회원작성글 영혼가출중  |  02.04
Q. colony PCR 예상 밴드
안녕하세요 실험실 인턴 중인 대학생입니다. 콜로니 PCR 진행하려고 하는데, 실험 전 공부 중에 있습니다. PCR 진행해서 전기영동으로 내리게 될 때 뜨는 밴드가 insert gene 밴드인건 알겠습니다.   하지만 이 insert gene 사이즈를 ORF size로 봐야하는지 refseq size로 봐야하는지 잘 모르겠습니다. 예상 밴드의 사이즈를 알아야 확인할 수 있을텐데,,, 예상 밴드 사이즈를 어떻게 책정?할 수 있을까요?     답변 부탁드립니다 ㅜㅜㅜㅜㅜㅜ
회원작성글 뜌두듄  |  02.02
Q. Multiplex pcr에 관하여
안녕하세요 현재 2개의 primer의 온도 조건을 동일한 온도로 각 각 확립하였고, 이후 이 두개의 primer를 같이 넣어 multiplex pcr을 진행한 결과 primer dimer 부분이 검출되어 이 부분을 보완하고자 아래와 같이 진행하였는데 나오질 않네요ㅠ 조언부탁드려요..ㅠㅠㅠ (첫 결과에서는 각 각의 primer의 bp 부분에 band가 검출되었으나 dimer 부분이 있어 수정해야했음) 변경사항 1. 기존 pcr e tube total volumn을 25 ul 에서 50ul 늘려 기존과 같은 농도(20pmole)를 가진 primer의 첨가량만 줄여서 진행 1/2배, 1/4배( 0.5ul / 0.25ul) -> 실험 결과 ; 밴드가 검출되지 않음. 이후 추가 변경 사항 1.기존 pcr e tube volumn을 25 ul 에서 50ul 늘려 기존과 같은 농도(20pmole)를 가진 primer의 첨가량 변경 1배, 1/2배, 1/4배 (1ul, 0.5ul, 0.25ul) 2. cycle 수 30->35cycle로 증가 실험결과, 1배로 넣은 곳에서 희미한 band가 확인이 됨. 하지만 band가 너무 안보임... Multiplex pcr primer의 경우 uniplex할 때와 다르게 1ul씩 넣던걸 0.5ul씩 반으로 줄여서 넣어줘야 한다고 들어서 진행을 하였으나.. 잘 안되네요 도대체...multiple pcr을 어떻게 해야 정말 잘했다는 소리를 들을 수 있는지 선생님들의 스킬을 알려주시면 너무 감사드리겠습니다... 추가로 gel 제작시 저의 경우 EtBR을 첨가해주고 있는데(4ul/100ml) gel doc 촬영시 etbr이 너무 하얗게 빛이나 사진이 안예쁘네요ㅠ 추가 꿀팁이 있다면 알려주세요!
회원작성글 해조칼슘풍덩  |  02.02
Q. single band에서 melting curve가 multi peak가 나옵니다.
hMSC cell에서 hCOL1A1을 target으로 하는 primer를 제작하여 qPCR을 돌렸는데 melting curve가 2개 나옵니다. 총 6well에 했는데 6well 모두 multi하게 나옵니다. 심지어 2개 peak의 값이 각 well에서 조금씩 상이하게 나옵니다. TM은 똑같아요. 혹시몰라 sample gel에 전기영동 내려서 band 확인했는데 band는 one band로 나옵니다.... 이게 뭐가 문제인지 알 수 있을까요
회원작성글 kyunk  |  02.02
Q. qPCR시 tamra pimer를 sybr green에 혼용해서 사용해도 되나요?
안녕하세요.  qPCR을 primer를 논문에서 찾아봤는데 tamra primer를 사용한 논문을 찾았습니다.  protien F,R primer서열 + FAM-5’ TTCCGGGATGCCGCTGCAAAG3’-TAMRA 알려주었는데 저희 랩은 sybr green을 사용해서 protein F,R서열만 가져와서 qPCR을 해도 괜찮을 거라고 생각이되는데 혹시 안되나요?? 서열 길이를 다 확인해본 결과 70-100bp내외였습니다.   추가적으로 sybr green으로 qPCR을 진행 할 경우 100-200bp내외로 primer을 구상한다고 하던데 250bp정도로 길어지면 문제가 발생 할까요?
회원작성글 규쟁  |  01.31
Q. qRT-PCR cycle 관련 궁금증 질문
안녕하세요? real time pcr 련해서 질문이 있어서 글을 남깁니다. 논문 작성에 있어서 Target A와 B 를 real time pcr을 진행하는데에 있어서 같은 cycle로 진행하여 결과를 실어야하나요??? 예를 들어 Target A는 30cycle 쯤에서 Ct 값이 확인되지만 Target B는 40cycle 쯤에서 Ct 값이 확인된다면 둘다 동일하게 40cycle로 진행해서 논문에 실어야 하는지요?? 제 생각에는 어차피 threshold (Ct)값은 변하지는 않을 것이기 때문에 각각 최적의 cycle로 진행하면 된다고 생각하는데 (Target A는 30cycle,Target B는 40cycle)어떻게들 생각하실까요?? 감사합니다.
회원작성글 RTO1  |  01.26
Q. PCR 결과 해석 방법에 관한 공부
안녕하세요 회사 인턴생 입니다. 이번에 PCR에 대해 공부하고 있는데 PCR의 기본 원리 작동 방법들은 어느 정도 알았는데 결과 해석 및 그래프 해석하는 방법을 몰라 조언을 구해보려고 합니다. PCR 결과 해석하는 방법이나 그래프 분석하는 방법들을 정리해놓은곳이 있을까요? 일반 PCR , Reverse Transcription PCR , Real Time PCR 들의 결과 해석법 배우는 곳을 알고 싶습니다.
회원작성글 오리5리Oh리  |  01.25
Q. PCR 실험에서 annealing 온도를 높일수록 잡밴드가 많이 생깁니다. 왜그런건가요?
안녕하세요 PCR실험을 할때 비특이적 밴드가 잡혀서 annealing 온도를 2도씩 올리면서 실험을 하고 있는데요. Tm값은 59도 이고 55도로 실험을 했을때보다 57도 59도로 실험을 했을 때가 더 잡밴드가 많이보입니다. 보통 온도를 높이면 primer와 template간의 mismatch가 감소해서 반응 특이성이 증가하여 잡밴드가 오히려 사라진다고 알고있는데요... 저처럼 이런 경우도 있나요?? 알려주세요!!
회원작성글 굴몽  |  01.19
Q. real-time PCR 논문 해석이 안됩니다,, 도와주세요ㅠ
선배님들 제가  Development of a rapid and sensitive reverse transcription real-time quantitative PCR assay for detection and quantification of grass carp reovirus II 논문을 읽고 있는데 도저히 이해되지 않는 table이 있어서 질문 올립니다,, table 3번이고 표에서 의미하는 +, -가 무엇에 대한 pasitive이고 negative인지 모르겠고 왜 이런 결과인지를 도저히 논문만 읽고는 이해가 되지 않네요,,   제가 많이 부족한가봅니다 아시는분 설명 부탁드립니다ㅜ  
회원작성글 롤로야놀자  |  01.18
Q. qPCR에서 ct값은 비슷하지만 rfu값 차이가 나는건 왜 일까요?
1. 위은 사진처럼 ct값은 비슷하나 rfu값이 차이가 나서 문의 드립니다. 같은 튜브에서 반복시험한것인데 저런차이가 왜 발생했을까요? 사용해도 되는 결과일까요? 2. 그래프가 눕는?현상이 발생하였는데 이유가 궁금합니다.   
회원작성글 vanana  |  01.17
Q. 2(Beta)-Mercaptoethanol 관련 질문
안녕하세요. 저희 연구실에서 이번에 dPCR을 도입하게 되어 2(Beta)-Mercaptoethanol을 취급하게 되었습니다. 그런데 2(Beta)-Mercaptoethanol을 주사기로 그냥 뽑아서 비커에 담으면 후드 안인데도 불구하고 상당히 독한 냄새가 나서 이를 어떻게 병에서 꺼내어 이용할지 어려운 점이 많습니다. 혹시 2(Beta)-Mercaptoethanol을 이용하고 계신 선배님들은 어떻게 사용하고 계신지(주사기 등) 궁금해서 질문 드립니다. 항상 감사드립니다.
회원작성글 Rise  |  01.16
Q. 구강상피세포 dna 전기영동 첨부파일
구강상피세포를 추출한 후 pMCT118 프라이머를 사용하여 pcr 한 걸로 전기영동을 진행한 결과입니다. 대조군으로 100bp와 1kb를 활용했는데 결과를 어떻게 분석해야 하는지 모르겠습니다. 위치상 100bp와 1kb를 비교해서 무엇을 알 수 있나요? 그리고 bp를 알고난 후 각각의 구강세포 dna에 대해 어떤 결과를 얻을 수 있을까요?
회원작성글 whatisit  |  01.15
Q. pcr 관련 시약 질문
pcr 할 때 dNTP, Taq polymerase는 무슨 역할을 하나요? DNA template와 Primer1(F)와 Primer(R)의 차이는 무엇인가요?
회원작성글 whatisit  |  01.14
Q. 프라이머 보관..
안녕하세요..이번에 학부연구생 시작한 사람입니다. 착각해서 프라이머 이틀정도 실온보관 했는데 다 깨졌을까요..??
회원작성글 asdsas  |  01.10
Q. HPLC Grade Water 구매처 질문
안녕하세요. 저희가 PCR에 이용할 HPLC grade water 구매처를 찾고 있는데, 1L, 4L 등 대용량으로 판매하는 곳밖에 존재하지 않아서 질문드립니다. 혹시 10ml, 20ml 등 소량으로 판매하는 곳을 아시는 분이 계시다면 답변 부탁드리겠습니다. 감사합니다!
회원작성글 Rise  |  01.09
이전  1 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
머크 광고