[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
MCI
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioLab 장재봉 교수
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-RNA
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. cDNA 합성 전 rna 농도
제가 RT-PCR을 하려고 RNA을 뽑았습니다. 6-well에 6*10^5 cell/ml 로 시딩하고 처리하고 RNA를 뽑는 과정에 pallet이 매우 적어서 걱정을 했습니다. cDNA 합성전에 RNA 농도를 측정하였는데 전에 동일한 조건으로 뽑았는데 400~600ng/ml 대로 나왔습니다. 그리고 cDNA 합성할때 농도를 1ml에 맞춰서 계산합니다.   근데 이번에 RNA 농도가 none이 77이 나오고 처리한 것들도 300ng/ml가 나왔습니다. 머가 문제일까요?.... cDNA 합성하게되면 계산을 해보니 none은 13ul를 넣어야하더라고요... 이렇게 해도되나요?... 아니면 다시 처음부터 해야되나요ㅜㅜ  
회원작성글 oneday  |  02.02
Q. RNA
 Melan a cell 조직에서 Trizol을 사용하여 RNA를 추출하였습니다. 조직 lysis 후 , Trizol에 chloroform을 넣어 vortexing하여 섞은 후, 몇 분 방치 한후 13000rpm 에서 10분간 centrifuge하였습니다. 4도씨에 1-3 시간 보관하고 (70% 에탄올로 washing 13000rpm 에서 10분간 centrifuge 3 번 하였습니다). 5분 건조하고 0.1% DEPC 20 μl 넣었습니다  RNA를 측정하였을때 A260/A280은 1.9정도 나오는데,  A260/A230은 2.3정도 나옵니다 ㅠㅠ.  cDNA 합성해도 될까요? A260/A280 과 A260/A230 값이 얼마정도 좋아요?  어떻게 해야 해결될지 고수님들 의견 부탁드립니다 ㅠㅠ
회원작성글 karan  |  01.26
Q. mRna extraction에 대한 질문
S.aureus를 이용한 실험을 진행하고 있는 대학원생입니다. 새로운 실험을 계획하고 있는 중인데 Protein analysis와 mRNA analysis 중에서 어떤 부분이 더 좋을지에 대해 고민을 하고 있습니다. Protein analysis를 통해 확인하는 것으로 진행하는게 좋다고 생각하지만, micro 수준이 아닌 nano concentration이라면 Protein analysis는 어려울 수도 있다고 생각되어 대안으로 생각 중입니다. 실험 조건은 실험동물에게 infection을 시킨 후 일정 시간이 지난 후의 bacteria를 isolation 하여 즉시 mRNA analysis를 진행하게되면 in vivo 환경에서 벗어나게 되고, 이 과정에서 mRNA extraction 과정에서 gene expression rate의 변화가 발생할 것으로 생각됩니다. 주변 환경 변화에 빠르게 반응하는 gene이라면 실험에 차질이 있을 수도 있다고 생각되는데 이를 제어할 수 있는 방법이 있는지, 혹은, 무시해도 될 정도의 변화인지 궁금합니다.
회원작성글 jsun2809  |  01.16
Q. pre-miRNA primer design
이번에 precursor miRNA를 qPCR 하기 위해 primer를 design 하게 되었는데요 miRNA qPCR용 primer design을 할 수 있는 프로그램이 뭔가 많아보이는데 유료인 것 같기도 하고 제가 잘 다룰 줄을 몰라서 직접 디자인하였습니다. 일단 일반 PCR 하듯 design했는데 다른 사이트에서 보니 SYBR green prove를 고려해서 design 해야한다는 말을 본 것 같아서 잘 만든게 맞는지 모르겠습니다. precursor miR seq 5’TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCATATGGATTACTTTGCTATGGAATGTAAGGAAGTGTGTGGTTTCGGCAAGTG3’  3’ACGAAGGGCTCCGGTGTACGAAGAAATATAGGGGTATACCTAATGAAACGATACCTTACATTCCTTCACACACCAAAGCCGTTCAC5’(빨간 부분은 mature mir seq이라서 primer 겹치면 안돼요!) F: GCTTCTTTATATCCCCATATGG (22nt, TM 52, GC% 41) R: GCAAAGTAATCCATATGGGGATA (23nt, TM 54, GC% 40)
회원작성글 별헤는밥  |  01.10
Q. RNA 추출 실패.. 이유가 뭘까요? 첨부파일
안녕하세요 RNA seq을 위해 RNA 추출을 몇 번이나 하고 있는데 전부 RNA가 깨져서 나옵니다. 어떤 스텝에서 잘못되었는지 알수가 없어서 글을 올리게 되었습니다. Trizol 사용한 매뉴얼로 추출 중인데.. 전부 깨져서 band 세개중에 제일 아래에 전부 몰려있습니다 260/280은 1.7, 2.1, 2.0로 나오고 260/230은 1.7, 2.2. 2.2 입니다.   우선, 시료는 몇 달전 샘플링하여 은박지로 싸서  -80도의 deepfreezer에 보관중입니다. 실험 전 실험에 쓰이는 모든 도구들(튜브, 팁통, 시약 스푼, 막자사발, 아이스버킷, 랙, 책상, 피펫 등등)은 RNAzap을 뿌려주었습니다.  샘플 무게는 50-100mg 사이로 맞췄고, Trizol, Chloroform 넣은 후에는 tapping, inverting으로 섞어주었고,  isopropanol 넣은후에는  천천히 부드럽게 inverting해주었습니다 에탄올 넣은 후 pellet이 잘 안떨어져서 강하게 tapping했는데 그게 깨짐의 원인이 될까 이번에는 안떨어져도 그냥 centri돌렸는데... 이거나 저거나 결과는 안좋네요 ㅠㅠ 드라이 할때 pellet건드릴까봐 천천히 말렸는데 오히려 pellet이 건조되어서 한번에 다 빨아들인 후 남은건 짧게 spindown후 10ul tip으로 빨아들이고 건조한후 DEPC 넣었습니다 여러 스텝들 사이사이 RNAsezap은 손에 수시로 뿌려주었어요 의심point들입니다 1. Zap으로 뿌린후, 손이 느려서 좀 오래 방치되었는데(도구들) rnase에 노출되었을까요 2. 에탄올이 덜 흡수가 되어 그런걸까요? 벽면에 진짜 쪼그맣게 있긴 했는데..   이번에는 상층액도 욕심 안부리고 400ul 만 뽑고, pellet 안건드리려고 tapping도 조심스럽게 했는데 결과가 안좋아서 속상하네요.  아님 샘플 자체에 문제가 있는걸까요..   +) 앗 사진이 돌아가있네요 ㅠㅠ 제일 밝은게 아래쪽 세번째 band입니다
회원작성글 도핑  |  01.06
Q. Control group에 없는 유전자 발현시 RT-qPCR ddCT값을 계산할 수 있나요 ??
 새해복 많이받으십시요 선생님들.   어떤 cell line에 해당 cell line은 발현하지 않는 외부 유전자 (ex. 바이러스의 병원성 유전자)를 발현시키는 벡터를 transfection한 경우 해당 외부 유전자의 발현양을 2^-ddCT 값으로 계산할 수가 있나요???   Control group에서는 target에 대한 qPCR ct값이 찍히지 않기 때문에 계산이 안될 것 같은데... 혹시 이런경우 정량하는 방법이 따로 있는지요 ??   읽어주셔서 감사합니다. 
회원작성글 Anchovy  |  01.03
Q. small RNA primer 디자인
small RNA 를 타겟으로해서 정량을 해야해서 primer를 디자인하려는데 주로 사용하던 프라이머 디자인 프로그램을 사용하려니 서열이 짧다고 안되네요ㅠㅠ smallRNA primer를 제작하고자 하는데 어떤 프로그램이 있을까요..?
회원작성글 별헤는밥  |  01.03
Q. 조직 RNA 분해 시기
동물 희생 후 조직 채취한 후 부터 RNA 분해가 빠르게 진행되는 것으로 알고있는데 수치적으로 RNA 분해가 어떻게 진행되는지 알고계시는 분 계실까요?
회원작성글 나나콘  |  01.02
Q. miRNA primer
precursor miRNA를 qPCR하려고 NCBI에서 시퀀스 서열을 확인한 뒤 프라이머를 만들었습니다. 근데 궁금한 점은 mature miRNA가 precursor miRNA에서 만들어지는데 precursor miRNA의 3',5'의 프라이머가 mature miRNA에 붙어서 인식될 경우는 없는 걸까요? 그리고 다른 질문들 보니까 precursor miRNA가 primary miRNA에 붙을 가능성에 대해 걱정하시던데 small RNA isolation kit를 이용하면 200nt 보다 작은 rna만 추출되니까 이 부분은 걱정 안해도 될까요? 이 쪽 분야를 이제 막 시작하게 되어서 공부중인데 precursor miRNA에 관해선 정보가 많이 없어서 브릭에서 활발히 지식 나눔해주시는 선배님들께 자문을 구합니다ㅠㅠ
회원작성글 별헤는밥  |  2022.12.28
Q. DNA 컨탐있는 RNA에 DNase I 처리 시 질문
안녕하세요. RNA를 추출했는데 조직량이 많아 DNA 컨탐이 되었습니다. qPCR을 돌리기 위해 DNase I처리를 하려고 하는데 protocol이 templeate가 DNA로 설정되어있습니다. RNA에 처리하려고 하는거면 1. nanodrop을 DNA로 다시 흡광도를 찍은다음 처리해야하나요? 2. RNA농도를 기준으로 처리하면되나요?   *추가정보 Zebra fish 의 whole body를 대상으로 추출했고 trizol의 양이 부족했습니다.(이부분은 다음부터 주의하겠습니다.)많은 양의 DNA가 컨탐되어 NRT값으로 qPCR을 돌려도 peak가 뜹니다.따라서 DNase I를 처리하고자 했습니다.  
회원작성글 아라온  |  2022.12.27
Q. RNA in situ hybridization 문의입니다
안녕하세요! 여러분 중에 in situ mRNA hybridization on tissue slice를 하시는 분이 있는지 궁금합니다! 어떤 kit를 사용하고 probe는 어디서 구매하는지 궁금합니다. 그리고 평균 가격도요... ㅠㅠ 도와주실 수 있으면 감사하겠습니다.
회원작성글 해봄  |  2022.12.20
Q. dexamethasone 처리
안녕하세요. 근육세포로 근위축 실험을 하는 대학원생입니다. dexamethasone으로 근위축 유도를 하고 있습니다. qpcr 결과를 보면 normal과 dexmethasone을 treat 한 경우를 비교해보았을때,  근분화인자인 myogenine을 측정해보면 dexamethasone을 treat한 경우가 항상 높게 나옵니다. 몇번을 찍어봐도 이렇게 측정이 되는데. 이런 경우로 나온 적이 있으셨던분이 계신지. 정말 궁금합니다.. 도움 주세요 급합니다ㅠㅠ  
회원작성글 똑똑해지자  |  2022.12.15
Q. qPCR
안녕하세요. qPCR 연이은 실험 실패로 의욕상실에 빠져있는 학생입니다. 현재 cell로 얻은 샘플로 qPCR을 하는 중입니다. 제가 궁금한 점은  1. 경향이 반대인 결과가 자꾸 나옵니다. primer의 문제라고 생각을 해서 여러개를 주문한 상태인데, primer을 선택할때는 어떻게 하나요? 2. 똑같은 약물을 treat한 샘플(n=2)에서 qPCR 값의 너무 값의 차이가 큽니다. 손의 문제라 생각이 들어 최대한 정확하게 오차없이 진행하려 노력했구요. 이유가 궁금합니다. 해결하고 싶습니다 정말  
회원작성글 똑똑해지자  |  2022.12.15
Q. total rna 추출
total rna 추출 실험을 하였는데요. 프로판올을 넣고 10분간 기다렸다가 원심분리 10분한 다음에 작은 양의 rna가 침전되었는지 확인을 해야 되는데 육안에 전혀 보이지 않더라구요. 그래서 일단 에탄올 넣고 다시 4도 원심분리기에서 5분간 원심분리하니 그때 rna가 보이더라구요. 왜 에탄올 넣고 원심분리 하니까 보이게 된 걸까요??
회원작성글 시모나  |  2022.12.12
Q. Mammalian cell에서 RNA 뽑을 때, column 사용하는 키트가 월등히 잘 되나요?
안녕하세요~ BMDC 분화 과정 중에 나타나는 precursor들에서 RNA를 뽑으려고 합니다. trizol을 사용한 옛날(?) 방식으로 뽑고 있는데, cell 개수가 적기도 하고 제가 아직 숙달이 안된 것도 있고 해서 안정적으로 RNA가 뽑히지 않는 것 같습니다. pellet이 거의 보이지 않으니까 제대로 뽑힌 건지 확신 없이 실험을 진행하는 게 참 불안하기도 하고요 ㅠ takara 부터 시작해서 여러 회사들에서 rna extraction kit를 판매하던데, 이걸 사용하면 purity 측면에서 월등히 나은지,, 두 방법으로 모두 rna 뽑아보신 선배님들의 경험담을 듣고 싶습니다.   늘 큰 도움 얻어갑니다. 감사합니다!!
회원작성글 크리스12  |  2022.12.12
Q. Apotosis 관련해서 RT-PCR과, Western blot 관련해서 질문이 있습니다.
안녕하세요. 저는 세포 실험 관련해서 전공자가 아닌데 실험을 진행하게 됐는데 특정 단백질이나 mRNA 발현량에서 이론처럼 증가하거나 나오지가 않아서 지금 여러번 재실험을 하고 있습니다 ㅜㅜ   제가 궁금한 점은 1) Western blot에서 cleaved-caspase3가 안 보이는데 인터넷을 찾아보니 dead cell에서 apoptosis 관련 인자들이 나오니까 dead cell까지 같이 확인하라는 얘기가 있던데 dead cell까지 같이 harvest를 해서 진행해도 되는지랑.. 2) Dead cell까지 같이 harvest를 해서 b-actin을 확인하면 Control이랑 비교했을 때, b-actin의 양 차이는 없을까요..?   3) RT-PCR을 돌리고 있는데 Dead cell에서도 mRNA 발현량이 나오는지랑, housekeeping gene이 control 대비해서 차이가 나지 않을까라는 생각에 궁금해서 여쭤봅니다.. 
회원작성글 열심히는하고싶은  |  2022.12.12
이전  1 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고