[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
ACROBIOSYSTEMS
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
피부 마이크로바이옴 연구 동향
전체보기 안전점검 LABox
 카테고리: 전체 > Microbiology > etc.
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. Mixture를 만들때 농도에 따른 용량
안녕하세요. 농도에 따른 물질 혼합물을 만들려고 하는데요. 각 물질을 혼합하면 농도가 달라질거 같아서 계산을 하려는데 이해가 잘 안가서 질문을 드리게되었습니다. 혼합하려는 물질 stock 농도가  VEGF-A (100ug/ml) 특정 물질 (80nmol 동결건조 상태 -> PBS 80ul를 추가하여 80nmol/80ul로 만들어서 1mM) 제가 Mixture를 4ml 만들기 위해 VEGF-A와 특정물질을 특정 농도가 되게 만들려고하는데요. 4ml을 만들기 위해 DW에 VEGF-A는 100ng/ml농도가 되게, 특정물질은 33nmol이 되게 DW에 혼합을 할건데 각각 얼마나 넣어야 하는지 계산을 잘 못해서 질문을 드립니다... 꼭 좀 도와주시면 감사드리겠습니다. 
회원작성글 medi92  |  01.30
Q. 해당 균이 무슨 균인지 아시나요
YM agar에서 아래와 같은 형태의 균이 자랐는데 아래와 같은 형태의 균 이름을 알고 계시는 분이 있을까요...?   현미경 검경 결과도 첨부합니다.
회원작성글 Levilactob..  |  01.18
Q. 황포균 희석법에대해 질문 드립니다. 첨부파일
안녕하세요. 실험하면서 주입평판법(희석법) 을 진행했는데, 첨부한 사진을 보면 세가지 형태의 황포균이 확인되었습니다.   이론상으로는 배지 속에서 자란 균과 배지 표면에서 자란 균 두가지 타입으로 균이 자란다고 알고있는데,   제가 두번 반복해서 실험을 했는데 세가지 타입으로 균이 자라더라구요. 배지 속에서 자라는 균을 제외하고 넓게 퍼지면서 자란 균과 균을 중심으로 하얗고 투명하게 조금 번져서 자란 균 두가지 타입은 어떻게 이해하면 될까요? 질문드립니다.. 감사합니다!
회원작성글 세균걸  |  01.18
Q. 균수 계산하는 방법
소독액 성능시험에서 정해진 균수(1.5~5.0x10^8/ 6.0x10^~3.0x10^3) 로 희석하려고 하는데 희석 방법이 헷갈려서요! 예를 들어서 9.0x10^9짜리 균 2ml을 가지고 3.0x10^9를 만들려면 균주 1ml에 희석액 2ml을 넣어야 하는건가요?
회원작성글 비그리  |  01.12
Q. 액체 희석 항균실험(Dilution method, MIC test)에서 균 현탁액 농도를 어떻게 잡아야할까요
식물 추출물로 mic test를 진행하려고 하는데요 제가 sample을 만들 때 100% DMSO 100mg/mL 로 stock을 만들었습니다. MIC test를 하기 위해 최종농도는 1% DMSO 500ug/mL 로 잡고 10번 연속 희석을 하는 실험을 하려고 합니다. 각 균주에 맞는 1% DMSO  배양액을 만들었습니다.  그리고 난 뒤 샘플의 농도를 희석 하기 위해 이 배양액을 사용했습니다. 각각 1% DMSO 500, 250, 125, 63, 32, 16, 8, 4, 2, 1 ug/mL로 96 well plate에 50uL씩 주입하고 최종적으로 overnight(약 20시간)한 균 현탁액을 50uL를 주입하였는데 논문을 참고하면 Macfarland turbidity No. 0.5를 맞춰서 MIC test를 진행한다고합니다.   균 현탁액의 탁도를 어떻게 해야할지 모르겠습니다.  적절한 균 현탁액의 OD값이 있는 건가요?.. 잘 모르겠습니다..
회원작성글 밍맹몽망  |  2022.12.14
Q. 우유 속 미생물 첨부파일
공기와 차단된 상태의 우유를 가열한 후 일주일이 지나고 나서 마개를 열고 약 일주일 후의 우유 모습입니다. 우유 속에 생긴 미생물의 종류를 뭐라고 해야 할까요?
회원작성글 eunseong  |  2022.11.28
Q. 구강정상상재균
미생물 실험 중 병이 없는 사람의 구강에서 도말 후 Gram stain 한 현미경 1000배율 사진입니다. BAP배지, MAC 배지 중 BAP 배지에서만 자랐고, 비용혈, 포도알균으로 보이는데 정확히 무슨 균인지 알 수 있을까요?
회원작성글 콩이콩이  |  2022.11.17
Q. 세균동정실험
안녕하세요 대학생입니다.    미생물공학 실험 수업시간에 세균 동정실험을 하였는데 검체가 한미약품 메디락DS였어요. 근데 동정실험의 문제점이 한미약품 메디락DS라는데 그 이유를 모르겠어요ㅠㅠ 알려주신다면 감사하겠습니다. 배지는 API 50CHB 사용했습니다.
회원작성글 릴러말티즈  |  2022.11.17
Q. 생물공학 관련 종사자분 도움 부탁드립니다
관련 분야에 대해 알고 싶은 것이 있어서 쪽지부탁드립니다 4학년이라 도움이 많이 필요합니다..
회원작성글 kyw  |  2022.11.13
Q. 여러분 pcr 산물 dna 크기 예측이 어떻게 가능하죠? 첨부파일
바이러스는 cov-19입니디 사진에서 하란대로 했을 때 F primer의 sbjct는 28706 CACATTGGCACCCGCAATC 28724 R primer의 sbjct는 28833 GAGGAACGAGAAGAGGCTTG 28814 인데 이걸로 답을 어떻게 알 수 잇을까요 ㅠㅠㅠ
회원작성글 생선구이백반  |  2022.11.09
Q. advantec antibiotic assay paper disc
현재 실험실에서 항균력시험 관련주제로 연구 중입니다. advantec antibiotic assay paper disc 8mm, thick 과 8mm, thin 에 추출물 및 물질을 분주하여 실험하려고 합니다. paper disc에 몇uL씩 분주하여야 하는지 몰라서 여쭤봅니다.
회원작성글 주짱  |  2022.11.08
Q. 균주 농도를 10^5~10^6으로 맞춰야 하는 이유가 뭘까요?
안녕하세요~ 식품제조업체에서 살균기 검증 중에 궁금한게 있습니다. 대장균, 황색포도상구균, 곰팡이 균을 직접 접종해서 후살균 시 사멸되는지 검증을 진행 하려고 하는데   미국약전에 따르면 균의 농도가 10^5~10^6 CFU/ml 생균수로 맞춰 투입하여야 한다고 합니다.   근데 저희는 식품 제조업체고, 혹시 균의 농도가 10^4 정도 여도 살균 검증에 신뢰성이 있다. 는 것을 뒷받침할 근거자료가 있을까요??   답변 부탁드립니다.
회원작성글 매매미  |  2022.10.14
Q. 두가지 효소 혼합하여 사용
안녕하세요   제가 발효를 진행하는데 생산이 낮아 추가적으로 상업용 효소를 첨가하여 실험을 진행하고있습니다 그런데 상업용 효소를 첨가했을 때 첨가하지 않은 대조군보다 생산자체가 더 낮게 나오는데 어떤 이유가 있는지 혹시 답글 달아 주실 수 있나요 ㅠㅠ
회원작성글 으리으링  |  2022.09.29
Q. 항생 물질 넣은 배양 배지 실험 급합니다ㅠ
고등학생입니다. 내일 급하게 편백나무수(편백나무잎을 수증기 증류해 얻어낸 하이드로졸)를 넣은 LB배지를 제작한 뒤 그 위에 생활용품으로부터 채취한 세균시료를 도말, 배양시켜 증식 정도를 확인하는 실험을 진행하게 되었습니다. 배지는https://www.addgene.org/protocols/pouring-lb-agar-plates/ 링크를 참고해 만들 예정입니다. 여기서 궁금한 점이 생겨 질문드립니다. 1. 첨부한 링크를 보니 항생제를 증류수 1mL에 일정한 농도로 희석해서 한천 혼합물에 넣던데 편백나무수를 증류수에 희석하는 과정없이 그냥 1mL를 넣어도 될까요? 2. 편백나무수가 항생제처럼 배지를 제작할 때 넣어도 항균효과를 나타낼 수 있을까요? 3. 만약 학교 실험실에 펩톤이나 트립톤, 카제인 펩톤이 없다면 대신 분유를 사용해도 될까요? 안된다면 그밖에 사용할 수 있는 쉽게 구할 수 있는 재료 추천 부탁드립니다. 4. 필요한 준비물이 학교 실험실에 하나도 구비되어 있지 않다면 원래 있는 LB배지라도 녹여서 편백나무수를 넣은 배지를 새롭게 만들고 싶은데.. 괜찮을까요? 5. 배지를 제작 후 하루동안 건조시켜야 하는 건 알지만 급한 경우에는 접시에 넣고 30분 정도 굳힌 뒤 바로 세균 배양 실험을 진행해도 되나요? 미리 감사드립니다.
회원작성글 나는할수있어  |  2022.09.16
Q. MAC BROTH 배지성능하는법 도와주세요
특정미생물 시험을 하기 위해 E.coli 균주를 사용하여 MAC Conkey Broth 배지의 증식촉진 배지성능시험을 하려고합니다.  E.coli 1mL를 배지에 접종시킨 후 43℃에서 24시간 이하로 배양시켰는데 발육과 색의 변화가 전혀 없었습니다.(0.1mL 접종도 마찬가지, 인큐베이터의 온도는 43℃가 맞음, 48시간까지도 배양해봤지만 소용없음) MAC Conkey Agar배지에서는 E.coli가 잘 생장한것으로 보아 균주의 문제는 아닌듯싶습니다. 어느과정에서 문제가 발생한것일지 조언 부탁드립니다.  
회원작성글 짱스파  |  2022.09.06
Q. 항균활성 실험 미생물 카운팅 관련 질문
안녕하세요  업무 중 미생물실험을 진행하게 되었는데 학부때 진행해보고 세부적인 사항이 잘 기억이 나지 않아 질문 올립니다.    1. 항균활성 테스트를 진행 예정(paper disc법)  2. paper disc에 항생물질 투여  3. 논문 확인 시 시험균의 농도 값을 CFU/mL로 기입 4. 실제 실험을 할때 CFU/mL값을 어떻게 측정해야 되나요? 5. 각 균주별로 O.D값이 x일때 몇 CFU/mL 이다.    - 기존에 검량선을 측정하여 본 실험할때 배양액들을 다수 만들어서 목표하는 CFU/mL 값에 맞는 O.D값의 배양액을 사용하면 될까요?  - 걱정되는 것은 O.D값 측정을 위하여 균주를 접종할때 정확한 양을 접종하지 않을 경우에 배양시간에 따라서 차이가 발생할 수 있을 가능성 때문에 고민이네요..  해당 접종 액의 CFU/mL 측정을 어떻게 해야할까요 ㅠ 
회원작성글 drope32  |  2022.09.05
이전  1 02 03 04 05 06 07 08 09 10  다음
공지사항
2022년 실험Q&A 우수회원 안내
중고등학생의 과학실험주제나 방법 및 숙제에 대한 질문 자제 요청
실험관련연재
세오 연재중실전 실험 프로토콜 101
세오 (필명) (Cincinnati Children’s Hospital Medical Center)
곽민준 연재중랩노트
곽민준 (POSTECH 생명과학과)
신코 연재중분석장비 이야기
분석장비 탐험가 (필명) ((주)신코)
박은총 연재마감후배에게 주고 싶은 면역학 노트
박은총(Duke University)
Mr.S 연재마감의학계의 Spectaculum: 임상시험
Mr. S (필명) (연세대학교)
에스프리 연재마감실험을 해봅시다
에스프리 (필명)
이제욱 연재마감생명과학자 기초체력 다지기
이제욱 (오송첨단의료산업진흥재단, 신약개발지원센터)
금주의 인기Q&A
긴급!! mouse i.p injection 농도 문의 [1]
물질혼합 농도 및 용량 계산 (초보) [4]
Mixture를 만들때 농도에 따른 용량 [1]
계대배양 [1]
논문 그래프에서 *의 의미가 무엇인가요 [2]
HPLC 단당류 분석 [3]
TLC관련 문의!! 부탁드려요 [3]
몰수 계산 (초보) 제발 도와주세요 [1]
세포해동 [2]
특정 Colony만 plasmid yield가 낮게 나올 수도 있나요? [1]
최근답변자 우수답변자
대왕개구리SPEED

올챙이버그기

개구리CBD 김선..

개구리범수리

뒷다리에효효

개구리clickclick

알민드

앞다리medi92

대왕개구리안재진

꽃개구리Applied_Mi..

개구리처음처럼

개구리냥냥아빠

대왕개구리엘피스

꽃개구리착한사람

꽃개구리visavis

개구리닥눈삼

위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고