[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioLab 박소정 교수
전체보기 안전점검 LABox
 카테고리: 전체 > Microbiology > etc.
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. 우유 속 미생물 첨부파일
공기와 차단된 상태의 우유를 가열한 후 일주일이 지나고 나서 마개를 열고 약 일주일 후의 우유 모습입니다. 우유 속에 생긴 미생물의 종류를 뭐라고 해야 할까요?
회원작성글 eunseong  |  11.28
Q. 구강정상상재균
미생물 실험 중 병이 없는 사람의 구강에서 도말 후 Gram stain 한 현미경 1000배율 사진입니다. BAP배지, MAC 배지 중 BAP 배지에서만 자랐고, 비용혈, 포도알균으로 보이는데 정확히 무슨 균인지 알 수 있을까요?
회원작성글 콩이콩이  |  11.17
Q. 세균동정실험
안녕하세요 대학생입니다.    미생물공학 실험 수업시간에 세균 동정실험을 하였는데 검체가 한미약품 메디락DS였어요. 근데 동정실험의 문제점이 한미약품 메디락DS라는데 그 이유를 모르겠어요ㅠㅠ 알려주신다면 감사하겠습니다. 배지는 API 50CHB 사용했습니다.
회원작성글 릴러말티즈  |  11.17
Q. 생물공학 관련 종사자분 도움 부탁드립니다
관련 분야에 대해 알고 싶은 것이 있어서 쪽지부탁드립니다 4학년이라 도움이 많이 필요합니다..
회원작성글 kyw  |  11.13
Q. 여러분 pcr 산물 dna 크기 예측이 어떻게 가능하죠? 첨부파일
바이러스는 cov-19입니디 사진에서 하란대로 했을 때 F primer의 sbjct는 28706 CACATTGGCACCCGCAATC 28724 R primer의 sbjct는 28833 GAGGAACGAGAAGAGGCTTG 28814 인데 이걸로 답을 어떻게 알 수 잇을까요 ㅠㅠㅠ
회원작성글 생선구이백반  |  11.09
Q. advantec antibiotic assay paper disc
현재 실험실에서 항균력시험 관련주제로 연구 중입니다. advantec antibiotic assay paper disc 8mm, thick 과 8mm, thin 에 추출물 및 물질을 분주하여 실험하려고 합니다. paper disc에 몇uL씩 분주하여야 하는지 몰라서 여쭤봅니다.
회원작성글 주짱  |  11.08
Q. 균주 농도를 10^5~10^6으로 맞춰야 하는 이유가 뭘까요?
안녕하세요~ 식품제조업체에서 살균기 검증 중에 궁금한게 있습니다. 대장균, 황색포도상구균, 곰팡이 균을 직접 접종해서 후살균 시 사멸되는지 검증을 진행 하려고 하는데   미국약전에 따르면 균의 농도가 10^5~10^6 CFU/ml 생균수로 맞춰 투입하여야 한다고 합니다.   근데 저희는 식품 제조업체고, 혹시 균의 농도가 10^4 정도 여도 살균 검증에 신뢰성이 있다. 는 것을 뒷받침할 근거자료가 있을까요??   답변 부탁드립니다.
회원작성글 매매미  |  10.14
Q. Glutaraldehyde solution 10*1ml 사진
Glutaraldehyde solution 10*1ml 실물 사진이 필요합니다ㅠ 실험실에 있으신 분 있으면 부탁드려요ㅠㅠ
회원작성글 멍게  |  10.05
Q. 두가지 효소 혼합하여 사용
안녕하세요   제가 발효를 진행하는데 생산이 낮아 추가적으로 상업용 효소를 첨가하여 실험을 진행하고있습니다 그런데 상업용 효소를 첨가했을 때 첨가하지 않은 대조군보다 생산자체가 더 낮게 나오는데 어떤 이유가 있는지 혹시 답글 달아 주실 수 있나요 ㅠㅠ
회원작성글 으리으링  |  09.29
Q. 항생 물질 넣은 배양 배지 실험 급합니다ㅠ
고등학생입니다. 내일 급하게 편백나무수(편백나무잎을 수증기 증류해 얻어낸 하이드로졸)를 넣은 LB배지를 제작한 뒤 그 위에 생활용품으로부터 채취한 세균시료를 도말, 배양시켜 증식 정도를 확인하는 실험을 진행하게 되었습니다. 배지는https://www.addgene.org/protocols/pouring-lb-agar-plates/ 링크를 참고해 만들 예정입니다. 여기서 궁금한 점이 생겨 질문드립니다. 1. 첨부한 링크를 보니 항생제를 증류수 1mL에 일정한 농도로 희석해서 한천 혼합물에 넣던데 편백나무수를 증류수에 희석하는 과정없이 그냥 1mL를 넣어도 될까요? 2. 편백나무수가 항생제처럼 배지를 제작할 때 넣어도 항균효과를 나타낼 수 있을까요? 3. 만약 학교 실험실에 펩톤이나 트립톤, 카제인 펩톤이 없다면 대신 분유를 사용해도 될까요? 안된다면 그밖에 사용할 수 있는 쉽게 구할 수 있는 재료 추천 부탁드립니다. 4. 필요한 준비물이 학교 실험실에 하나도 구비되어 있지 않다면 원래 있는 LB배지라도 녹여서 편백나무수를 넣은 배지를 새롭게 만들고 싶은데.. 괜찮을까요? 5. 배지를 제작 후 하루동안 건조시켜야 하는 건 알지만 급한 경우에는 접시에 넣고 30분 정도 굳힌 뒤 바로 세균 배양 실험을 진행해도 되나요? 미리 감사드립니다.
회원작성글 나는할수있어  |  09.16
Q. MAC BROTH 배지성능하는법 도와주세요
특정미생물 시험을 하기 위해 E.coli 균주를 사용하여 MAC Conkey Broth 배지의 증식촉진 배지성능시험을 하려고합니다.  E.coli 1mL를 배지에 접종시킨 후 43℃에서 24시간 이하로 배양시켰는데 발육과 색의 변화가 전혀 없었습니다.(0.1mL 접종도 마찬가지, 인큐베이터의 온도는 43℃가 맞음, 48시간까지도 배양해봤지만 소용없음) MAC Conkey Agar배지에서는 E.coli가 잘 생장한것으로 보아 균주의 문제는 아닌듯싶습니다. 어느과정에서 문제가 발생한것일지 조언 부탁드립니다.  
회원작성글 짱스파  |  09.06
Q. 항균활성 실험 미생물 카운팅 관련 질문
안녕하세요  업무 중 미생물실험을 진행하게 되었는데 학부때 진행해보고 세부적인 사항이 잘 기억이 나지 않아 질문 올립니다.    1. 항균활성 테스트를 진행 예정(paper disc법)  2. paper disc에 항생물질 투여  3. 논문 확인 시 시험균의 농도 값을 CFU/mL로 기입 4. 실제 실험을 할때 CFU/mL값을 어떻게 측정해야 되나요? 5. 각 균주별로 O.D값이 x일때 몇 CFU/mL 이다.    - 기존에 검량선을 측정하여 본 실험할때 배양액들을 다수 만들어서 목표하는 CFU/mL 값에 맞는 O.D값의 배양액을 사용하면 될까요?  - 걱정되는 것은 O.D값 측정을 위하여 균주를 접종할때 정확한 양을 접종하지 않을 경우에 배양시간에 따라서 차이가 발생할 수 있을 가능성 때문에 고민이네요..  해당 접종 액의 CFU/mL 측정을 어떻게 해야할까요 ㅠ 
회원작성글 drope32  |  09.05
Q. PCA에서 자란 균 식별 부탁드립니다 첨부파일
Plate Count Agar에서 자란 균이고 48시간만에 완전히 자라지 않아서 하루 넘게 더 배양한 결과입니다. PCA에 균 분별능력이 없다는 것과 정확히 무슨 균인지는 동정해봐야하는 것은 알지만 위에서 육안으로 식별할 수 있는 방법이 없겠냐고 하셔서 혹시 아시는 분이 계신지 여쭤봅니다.. 사진상으로 2가지 균인 것 같아 보이지만 표준평판법이고 내부에서 자란 균도 약간 분홍색을 띄는 것으로 보아 배지속과 배지 표면 차이이지 같은 균이지 않나 싶습니다. 아시는 분은 댓글 부탁드립니다...
회원작성글 yeasting  |  09.05
Q. 대장균 CC 3M 질문좀요,,,,
     안녕하세요. 3M 대장균군 CC 페트리필름을 사용하면 쉽다고 해서     해보았습니다. 가축분뇨를 대상으로 유입/처리 수를 실험하였습니다.     실험은 시료+증류수 로 진행하였고, 유입수와 처리수를 각각 100배, 1000배 2000배 정도 희석해서 1ml 씩 따서 필름에 접종했고 실험의 재현성을     확인하고자 각각 유입수 100, 1000, 200배 3개씩 처리수도 동일하게     진행했는데.,,,,       그냥 다 다르게 나오네요 ㅋㅋㅋㅋㅋ,,,ㅠㅠ     어떤건 처리수가 더 크게 나오고 어떤건 아예 나오지도 않고     희석을 너무 적게 한건지 아니면 너무 많이 한건지 판단도 갈음할 수가     없네요,, ㅠ        고수분들 도대체 뭐가 문제인지 알려주시면 감사하겠습니다,,,      피펫질을 못하는건가,,,
회원작성글 대장균죽어라좀  |  08.26
Q. plate 끝에 퍼져서 배양되는 현상
안녕하세요. 한가지 궁금한것이 있어 여쭤보고자 질문 남깁니다.   혹시 배지를 이용한 균주 시험을 진행했을때 배지의 끝부분에 접종되어진 균들이 배양되어질때 끝을 타고 퍼지듯이 배양되는 현상을 부르는 말이 있는걸로 전해 들었는데 정확한 명칭이 무엇인지 알 수 있을까요....
회원작성글 구마짱  |  08.22
Q. 약전 미생물한도시험
제품에서 허용 가능한 미생물 회수 결과를 얻기 위해 가장 낮은 희석 배율의 검액으로 준비한다 이 뜻이 잘 이해가 안돼서요..! 가장 낮은 희석배율의 뜻이 희석을 여러번 하지 않은 비교적 높은 농도의 상태인가요? 또한 허용 가능한 미생물 회수 결과는 제품별로 정해져 있는 미생물 결과 기준치를 넘지않는 결과값 이라는 뜻인건가요?
회원작성글 yaam  |  08.12
이전  1 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고