[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
신테카바이오
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioWave  Vol.25, No.2 (2023년 2월) 오픈
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-DNA
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. Agarose 전기영동할때 sample이 퍼집니다.
DNA 전기영동하려고 Agarose gel에 로딩하려고 하는데 sample이 가라앉지 않고 TAE buffer안에서 퍼져서 확산됩니다. PCR product는 아니고 mRNA 합성한것 내려본 것입니다. 샘플이 날라가버렸는데 어떤 컨디션이 안맞는걸까요?
회원작성글 nuco  |  02.06
Q. qPCR 전기영동 band dimer 질문입니다.
평소 실험을 할 때 dimer가 50bp 근처에서 생겨났는데  이번 실험에서는 한참 아래쪽에 band가 생겨서요 이게 dimer라고 하기에는 size가 너무 작아서 질문 드립니다.     목표 product는 70bp정도이고 DNA ladder는 50bp 사용했습니다
회원작성글 안일한녹조식물  |  02.06
Q. 전기영동할 때 DNA marker가 삐뚤삐뚤하게 내려와요
안녕하세요! 전기영동할 때 DNA marker (ladder)관련해서 질문드립니다. 맨 왼쪽은 100bp짜리 ladder이고 dye가 포함되어있는거라 2ul 로딩하였고 두번째 lane은 1kb짜리이고 dye가 포함되어있지 않은거라 6X loading dye와 비율 맞추어 섞은 뒤 2ul 로딩하였습니다. 100V로 한시간 running하였는데 100bp짜리는 가지런하게 내려오는데 1kb짜리는 왜 저렇게 사선으로 내려올까요?ㅠㅠ 해결방법 아시는분~! ㅠㅠ 젤은 0.8% agarose입니다!
회원작성글 jeongjjang..  |  02.06
Q. PCR mixture 제조관련 질문
안녕하세요 궁금한 점이 생겨 이렇게 글을 올립니다.  현재 g사의 PCR KIT를 사용하고 있으며, mixture제조시  buffer, dNTP, DW로만 혼합하여, 분주하여 사용합니다.  제가 궁금한 점은 DW의 경우 Make up을 위해 첨가하는 것이기도하고, DNA의 농도가 각 각 다르기 때문에 Mixture의 분주량이 달라지는데 이럴 경우 buffer, dNTP의 양이 제대로 들어가는지 의문이기에 여쭤봅니다.  물론 사용하기 전에 피펫팅이며, 볼텍싱이며 제대로 섞어주려고 신경은 써줍니다.    
회원작성글 해조칼슘풍덩  |  02.06
Q. 희석 계산 질문이 있어서 질문드립니다.
저희가 가지고 있는 시약은  0.25mg 의 NAD 입니다. (Molecular Weight는 663.43 입니다) 1M NAD 를 만들려고 하는데, 어떻게 계산을 해야 하나요? 
회원작성글 Illl!Ill  |  02.06
Q. cloning 과정 ampicilin plate
ligation 후 E.coli competent cell 에 transformation을 진행 후 ampicilin plate에서 키운 후 overnight 된 뒤 plate를 확인해보면 콜로니가 골고루 plate에 뜨는게 아니라 가운데 콜로니 하나에 주변에 콜로니가 모여서 뜨는 현상이 나타납니다. 냄새도 오염된거 같은 냄새가 나고요. competent cell이 문제인가 싶어 바꾸서 진행해도 똑같은 현상이 일어나서 질문드립니다. 제가 ligation 시 vector와 insert의 농도를 잘못 계산하여 진행해서 이런 현상이 발생하는것인지, 아니면 실험과정에서 오염이 발생해서 이러한 현상이 나타나는것인지 궁금해서 여쭤봅니다
회원작성글 분자생물학도  |  02.06
Q. PCR primer design 도전 중 고난과 역경..
안녕하세요 최근 PCR을 세팅하고있는 피린이 입니다. 현재 apoptosis 관련된 마커들을 몇가지 확인하고자 primer design을 진행 중 입니다. 여기서 한 가지 궁금한 점이 생겨서 이렇게 질문드리게 되었습니다.  보통 Primer를 짜기 전에 보고자하는 유전자서열을 전체 긁어온뒤 프라이머를 짜고있습니다. 조금 더 구체적으로는 NCBI, UCSC 에서 해당 유전자를 검색하고 타겟 유전자를 불러와 유전자멥을 그려놓습니다. 프라이머를 20-24 mer 정도의 크기로 Tm 값이나 GC%, target gene size 등 확인하며 디자인 진행 중에 있었습니다. 여기서 궁금한 점은 다음과 같습니다. 1) target gene만 인식하는지는 어떤식으로 평가를 하시나요? 2) cleaved form 의 유전자들을 어떻게 디자인을 해야할까요..?? 유전자를 검색해도 cleaved ~~~ 이렇게 검색하면 따로 검색이 되지 않아서 위의 방식으로 디자인을 진행하지 못하고 있습니다..ㅎㅎ.... 여기저기 검색해가며 찾아보려하는데 이렇다할 해답을 얻지 못했습니다ㅠㅠ 물론 다른 논문들을 찾아보면서 해당 primer의 sequence를 얻을 수는 있었습니다만, 저는 제가 직접 짜는 방법을 알고있는 것이 더 좋을거라 생각이 들어 이렇게 질문드립니다.  염치없지만 PCR 고수님들은 보통 어떻게 찾으시는지 도움을 부탁드리겠습니다!!
회원작성글 대하권생  |  02.05
Q. midi prep 이후 plasmid electrophoresis했을 때 이상한 밴드가 나옵니다. 첨부파일
선생님들 안녕하십니까? 학부생입니다. 현재 plasmid를 DH5a cp cell에 transformation해서 midi prep한 다음 confirm하는 과정을 진행중인데요. 이상한 밴드가 계속 나와서 머리가 아픕니다...   gel은 0.7%고 non-cut plasmid입니다. plasmid가 맞는지만 적당히 확인하기 위해 cut은 안했고요. 사진에서 2번레인이 이전에 쓰던 것이고 (stock) 3,4 번레인이 새로 midi한건데  위쪽의 supercoil이나 nick 이런 밴드는 알겠는데 밑에 100-300bp?에 이상한 밴드가 눈에 보일정도로 진해졌네요. 자세히 보면 맨 윗밴드도 진해진 것 같고요. 이 밑에 밴드가 뭔지 모르겠습니다. 이전 랩에서 midi하면서 이런 밴드를 본 기억이 없는데.. contamination된건지?    260/280값이 조금 높게 나오기는 하는데 (1.9이상) 이건 stock midi했을 때에도 마찬가였습니다. 아마 midi에 쓰는 buffer가 오래된 거라 그런 것 같은데.. 그걸 감안해도 눈에 보이지 않던 밴드가 진해져서 머리가 아프네요.   제가 생각하기에는 gDNA나 RNA가 섞여있거나 (당연히 Sol1에 RNase A 처리하고 4도씨 보관, 실험중에도 ICE보관하면서 했습니다) plasmid denaturation이 되어서 single strand가 나왔거나(이전에도 똑같이 inverting하고 lysis 5분했는데 왜..) 하는 것 같은데 이걸 어떻게 해야 할 지 모르겠습니다.  transfection할 때 사용할 거라 이상한 것 같으면 처음부터 그냥 새로운 CP cell 까서 buffer까지 새로 바꿔버려야 할지... RNase나 enzyme cut을 시도해봐야 할지 고민입니다. 만약 RNA contamination이라면 RNase를 처리하고도 293T에 transfection 할 수 있는지도 궁금합니다. 사용한 midi kit는 N*****B**** kit입니다.  이전에 Q사에서는 이런게 보이지 않았던 것 같은데.. 아무리생각해도 잘 모르겠네요. Neutralization 이후 ICE incubation과정이 없어서 그런건지..   도와주세요 선생님들.. 
회원작성글 큰곰인형  |  02.05
Q. qPCT Tm값
안녕하세요. qPCR을 처음 해본 학부생입니다. qPCR 진행 후 Tm값 결과를 얻었는데, PCR mixture가 약간 부족했던 튜브만 Tm값이 살짝 다른 위치에 나왔는데 Tm값과 PCR mixture volume이 어떤 관계가 있는건지 궁금합니다!! PCR mixture 양이 아주 달랐던건 아닌데 이거 말고는 원인이 없는거 같습니다… 너무 궁금해서 계속 찾아봤는데, 구글링해봐도 잘 모르겠습니다ㅠㅜ 아직 부족한 부분이 너무 많습니다. 너그럽게 이해해주시고, 알려주시면 정말 감사하겠습니다 !!
회원작성글 영혼가출중  |  02.04
Q. 실험하다답이안나와요
1번 100pmol primer를 10pmol 로 희석을하고 10pmol에서 3.2pmol을 만들려면? 2번 PCR밴드가 끌리면? 어떻게 해야하죠?
회원작성글 콩콩콩콩  |  02.03
Q. cloning 과정 질문드립니다.
vector 와 insert에 enzyme cut 진행 후 ligation을 진행할려고 하는데요 2개의 enzyme를 사용하다 보니 gel 상에서 band가 2개가 나오긴 하는데 이걸 제가 원하는 size부분을 gel extraction으로 자르고 ligation을 진행하는 걸까요? 아님 그냥 진행하는 걸까요?
회원작성글 분자생물학도  |  02.03
Q. colony PCR 예상 밴드
안녕하세요 실험실 인턴 중인 대학생입니다. 콜로니 PCR 진행하려고 하는데, 실험 전 공부 중에 있습니다. PCR 진행해서 전기영동으로 내리게 될 때 뜨는 밴드가 insert gene 밴드인건 알겠습니다.   하지만 이 insert gene 사이즈를 ORF size로 봐야하는지 refseq size로 봐야하는지 잘 모르겠습니다. 예상 밴드의 사이즈를 알아야 확인할 수 있을텐데,,, 예상 밴드 사이즈를 어떻게 책정?할 수 있을까요?     답변 부탁드립니다 ㅜㅜㅜㅜㅜㅜ
회원작성글 뜌두듄  |  02.02
Q. Multiplex pcr에 관하여
안녕하세요 현재 2개의 primer의 온도 조건을 동일한 온도로 각 각 확립하였고, 이후 이 두개의 primer를 같이 넣어 multiplex pcr을 진행한 결과 primer dimer 부분이 검출되어 이 부분을 보완하고자 아래와 같이 진행하였는데 나오질 않네요ㅠ 조언부탁드려요..ㅠㅠㅠ (첫 결과에서는 각 각의 primer의 bp 부분에 band가 검출되었으나 dimer 부분이 있어 수정해야했음) 변경사항 1. 기존 pcr e tube total volumn을 25 ul 에서 50ul 늘려 기존과 같은 농도(20pmole)를 가진 primer의 첨가량만 줄여서 진행 1/2배, 1/4배( 0.5ul / 0.25ul) -> 실험 결과 ; 밴드가 검출되지 않음. 이후 추가 변경 사항 1.기존 pcr e tube volumn을 25 ul 에서 50ul 늘려 기존과 같은 농도(20pmole)를 가진 primer의 첨가량 변경 1배, 1/2배, 1/4배 (1ul, 0.5ul, 0.25ul) 2. cycle 수 30->35cycle로 증가 실험결과, 1배로 넣은 곳에서 희미한 band가 확인이 됨. 하지만 band가 너무 안보임... Multiplex pcr primer의 경우 uniplex할 때와 다르게 1ul씩 넣던걸 0.5ul씩 반으로 줄여서 넣어줘야 한다고 들어서 진행을 하였으나.. 잘 안되네요 도대체...multiple pcr을 어떻게 해야 정말 잘했다는 소리를 들을 수 있는지 선생님들의 스킬을 알려주시면 너무 감사드리겠습니다... 추가로 gel 제작시 저의 경우 EtBR을 첨가해주고 있는데(4ul/100ml) gel doc 촬영시 etbr이 너무 하얗게 빛이나 사진이 안예쁘네요ㅠ 추가 꿀팁이 있다면 알려주세요!
회원작성글 해조칼슘풍덩  |  02.02
Q. single band에서 melting curve가 multi peak가 나옵니다.
hMSC cell에서 hCOL1A1을 target으로 하는 primer를 제작하여 qPCR을 돌렸는데 melting curve가 2개 나옵니다. 총 6well에 했는데 6well 모두 multi하게 나옵니다. 심지어 2개 peak의 값이 각 well에서 조금씩 상이하게 나옵니다. TM은 똑같아요. 혹시몰라 sample gel에 전기영동 내려서 band 확인했는데 band는 one band로 나옵니다.... 이게 뭐가 문제인지 알 수 있을까요
회원작성글 kyunk  |  02.02
Q. Maxi prep yield가 낮은 이유를 잘 모르겠습니다...
안녕하세요. 인턴으로 일하고 있는 대학생입니다.   이번에 두 종류의 Plasmid를 Maxi prep 하게 되었는데요. 하나는 1800ng/ul에 purity는 1.91로 잘 나왔지만   다른 plasmid는 315ng/ul에 purity는 1.90, 260/230은 2.15로 결과가 심하게 차이가 났고, 이번에 다시 문제의 Plasmid들만 다시 2번의 maxi를 더 했으나 둘 다 purity는 1.90에 300ng/ul 언저리로 나와 질문드리고 싶어 작성하게 되었습니다..   실험의 경우, protocol 진행에 있어 1800ng/ul과 300ng/ul 두 pL의 다른 점은 없었습니다. 16시간 배양 후, 첫 centri에서의 pellet은 1800ng/ul의 pL이나 문제의 pL이나 모두 같은 양이 추출되었으나, 마지막 TE로 녹이기 전 Centri에서의 pellep 양은 확연한 차이가 발생하였습니다.   특히나, 개인적으로 궁금한 점은 흡광도에서 A260과 A280값이 1800ng/ul = 37, 19 300ug/ul = 6.3, 3.3 이렇게 나오는데, 이 경우 DNA의 양 뿐만이 아니라 Protein의 양도 적게 나왔으니, pL이 transfection 된 양이 적은 것이 아니라 protocol 진행에 미스가 났다고 봐도 되는걸까요..!   또한, pL 종류에 따라 최종 Yield 차이가 많이 날 수도 있는건가요??  
회원작성글 푸이잉  |  02.02
Q. transcription factor의 potential 관한 기본적인 질문입니다.
JASPAR등과 같은 사이트에서 특정 gene에 대한 특정 Transcription factor의 binding을 prediction하면, 어떤 T.F A같은 경우에는 promoter 기준 전후로 굉장히 많은 prediciton site가 나오고 또 다른 T.F. B는 prediction site가 많지는 않지만 promoter 바로 앞부분에 위치한 prediction site가 나오는데요. 기초적인 것일 수도 있는데 문득 이런 의문이 들었습니다. 그렇다면 A가 이 gene에 더 potential한 T.F일지 혹은 B가 더 강력한 inducer일지가 궁금해졌습니다. 경우에 따라 다를 것 같긴 하지만, 둘 중 어느 것이 더 potential하다고 봐야할까요? 
회원작성글 슈동  |  02.01
Q. 희석 계산 질문 드립니다.
저희 실험실에 NAD 시약 (Molecular Weight:663.43) 250mg이 있습니다. 저희가 필요한 stock의 농도는 100mM 인데 계산을 어떻게 해야 하는 지 질문 드립니다.... 1M NAD로 만들어서 100mM로 만들면 되는건가요?
회원작성글 Illl!Ill  |  02.01
Q. 전기 영동 후 gel purification
전기 영동 후 밴드를 잘라서 EP tube에 넣고 냉장고에 보관 후 약 20시간 후에 gel purification을 시작해도 될까요?
회원작성글 링가링가링  |  02.01
Q. promega genome dna 추출이 안되는 이유가 있을까요ㅠ
promega genome dna purification 키트 사용해서 진행했는데 프로토콜에서 protein precipitation solution 넣고 ice에 넣고 centrifuge 돌린후에 상등액 옮겨서 isoprophenol 넣고 centrifuge 돌리면 pellet이 생겨야하는데 아무리해봐도 pellet 없습니다.. cell양이 적은가해서 양도 늘려서 해봤는데 pellet이 다운이 안되는데 제가 놓친 부분이 있을까요..?
회원작성글 말하는걈쟈  |  02.01
Q. qPCR시 tamra pimer를 sybr green에 혼용해서 사용해도 되나요?
안녕하세요.  qPCR을 primer를 논문에서 찾아봤는데 tamra primer를 사용한 논문을 찾았습니다.  protien F,R primer서열 + FAM-5’ TTCCGGGATGCCGCTGCAAAG3’-TAMRA 알려주었는데 저희 랩은 sybr green을 사용해서 protein F,R서열만 가져와서 qPCR을 해도 괜찮을 거라고 생각이되는데 혹시 안되나요?? 서열 길이를 다 확인해본 결과 70-100bp내외였습니다.   추가적으로 sybr green으로 qPCR을 진행 할 경우 100-200bp내외로 primer을 구상한다고 하던데 250bp정도로 길어지면 문제가 발생 할까요?
회원작성글 규쟁  |  01.31
이전  1 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고