[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
이엔셀
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
Miami Winter Symposium 2023 – Molecular Neuroscience: Focus on Sensory Disorders 학회 참관기
전체보기 안전점검 LABox
 카테고리: 전체
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. 실험 프로토콜 어떤 방법으로 찾으시나요?
졸업 논문을 써야 할 시기가 다가옴에 따라 제 실험을 하나 해서 졸논을 써보고 싶어 준비중에 있습니다. 다양안 메탈 옥사이드 나노 입자를 합성해서 해당 입자들의 항균 능력과 농도를 비교 분석해보고 싶은데, 메탈 옥사이드 나노 입자 합성법을 찾을 방도가 막막하네요. 논문도 찾아보고 있는데, 어떤 키워드를 이용해서 찾아야 할지를 모르겠어서 혹시나 논문 찾을때 제가 원하는 논문을 찾을 수 있는 팁 좀 알려주시면 감사하겠습니다.
회원작성글 혼란스러운 연구생  |  03.14
Q. RNA 추출 시 주의사항
안녕하세요 RNA 추출 관련해서 궁금한 점이 있습니다. 먼저 RNA가 DNA보다 많이 안정성이 떨어져서 실험하는 과정도 주의하며 빨리 끝내야한다는 것은 알고 있는데   혹시 추출하고자 하는 식물체 잎을 미리 액체 질소로 분쇄하여 딥프리저에 보관 후  2주 정도 뒤에 분쇄해 둔 잎으로 RNA추출이 가능할까요?   불안하긴 한데 분쇄 후 생기는 loss 양이 있기에 샘플을 너무 버리는 것 같아서요.. 
회원작성글 해조칼슘풍덩  |  03.14
Q. pcr primer design 질문 드립니다
RFP protein의 일부를 잘라내 subcloning하는 실험을 하고 있습니다.   Sal1, kpn1 제한효소 사용하여 forward primer, reverse primer를 디자인 해야 하는데 제가 맞게 했는지 잘 모르겠어서 질문 올립니다.   Forward primer(랜덤서열(5bp) + Sal1 제한효소 + DNA 서열(15bp)) 5' - GGTATGTCGACATGGCCTCCTCCGAG - 3'   Reverse primer(랜덤서열(5bp) + kpn1 제한효소 + DNA 서열(15bp)) 5' - TAAGAGGTACCGGCGCCGGTGGAGTG - 3'
회원작성글 타임  |  03.14
Q. Western blot 밴드가 휘는 현상 질문드립니다ㅠㅠ
안녕하세요. western blot 결과가 너무 왔다갔다해서 질문드립니다...ㅠ 거의 50퍼의 확률로 제대로나올때도있고 밴드가 휘어서 나올때도 있는데 도무지 원인을 모르겠습니다. SDS PAGE 까지는 항상 제대로 되기때문에 transfer 단계에서 뭔가 잘못되고 있는것같습니다....ㅠㅠ 현재 trasfer 실험 방법은 다음과 같습니다.  - sds page 할때 gel은 bio rad 사에서 만들어서 나오는 젤 사용, 러닝버퍼       도 시판 제품 사용  - 트렌스퍼 버퍼도 전부 10x로 파는 버퍼 1x로 희석해서 사용  - 트렌스퍼 버퍼는 전날 만들고 냉장고에 넣어둔 후 다음날 차갑게 사용  - 트렌스퍼 버퍼에 트레이에 부은 후 트렌스퍼 카세트에 얇은 스펀지 한장     적셔서 깔고 3M paper 3장 적셔서 깔고 전기영동된 gel(sds page 진행 후     트렌스퍼 버퍼에 담궈서 10분정도 씻어줌) 올리고 pvdf 멤브레인( 20분전     에 메탄올에 넣어서 10분간 활성화시켜주고 10분정도 트렌스퍼 버퍼에       워시해서 사용) 올리고 롤러로 기포빼줌, 그다음 적신 3M paper 3장 올리     고 적신 스펀지 한장 올린 후 살살 들어서 카세트 고정, 기기에 넣어주고       트렌스퍼 버퍼 끝까지 부어준후 100V 로 50분~1시간 트렌스퍼진행.(열       발생 최대한 막으려고 아이스로 기기 잔뜩 덮어주고 진행) - 성공했을 경우 밴드 경향 (원래 나와야하는 밴드 모양) - 실패했을 경우 나오는 밴드 경향 항상 위와 같은 방식으로 동일하게 진행하는데 어쩔때는 맨위의 사진처럼 밴드가 예쁘게나오고 어쩔때는 아래 사진들처럼 엉망으로 퍼져서 나옵니다.ㅠㅠㅠ 트렌스퍼 카세트가 헐거워져서 제대로 잡아주질 못해서 그런가?하고 카세트도 새로 구입해봤는데 여전히 성공비율 50%로 똑같고, 3M 종이 3장,3장 깔아주는게 너무 적나 싶어서 몇장씩 더깔아도 똑같습니다.  transfer 끝나고 검체부분은 안보여도 마커는 pvdf 멤브레인 상에 보이는데 마커가 일렬로 예쁘게 trasfer 되었어도 다음날 찍어보면 밴드가 엉망일때도 있고, 마커가 찌그러지고 엉망으로 나와도 다음날 찍어보면 밴드가 의외로 제대로 나올때도 있습니다. 뭐때문에 이러는지를 알아야 실험이 잡힐텐데 계속 이러니 버퍼도, 젤도 두배로 사용하고 실험시간도 두배로 걸려서 너무 힘드네요... 혹시 왜이러는지 아시는분있으실까요?
회원작성글 uk111  |  03.14
Q. 황화물계 시료 GC-MS나 ICP-OES 찍어보신 분 계신가요?
황화물계 고체전해질 연구중인데,  예를들어 원재료인 Li2S에서 Li이랑 S의 함량(wt%), 그외 나머지 불순물원소들(ppm)을 알고싶어서 ICP-OES 분석을 한다면 Li2S가 대기중에 노출되면 산화가 엄청 빠르게 진행되는 물질인데 그럼 시료 전처리 과정에서 원래라면 Li2S 중에서 Li랑 S 함량이 99.9% 이상이였는데 (불순물 0.1%) 산화되면서 99.9%보다 낮아질 수 있는건가요??   궁금합니다 ㅠㅠ  
회원작성글 혜온  |  03.14
Q. Hydrophilic polymer (Carboxylated styrene) washing 및 centrifugation
Styrene에 core-shell 구조를 만들기 위해 acrylic acid를 이용하여 carboxylated styrene을 합성하고 있습니다.   그런데 합성을 마친 후에 solution (colloidal) 상태에서 washing을 하기 위해 원심분리기를 돌려도 hydrophilic해서 모이질 않는데 이런 경우에는 washing을 어떻게 진행해야 하나요 ???    
회원작성글 박사노예  |  03.14
Q. Cloning 문제
안녕하세요 저는 현재 셔틀벡터를 이용해서 E. coli와 환경균주에서 분리한 Pseuarthrobacter에 사용되는  pSVJ21 vector를 이용해서 cloning을 하고있습니다.   여기서 제가 관련된 유전자를 transformation 한 뒤에 insert 양쪽 50 bp 씩 떨어진 곳에 primer을 제작해서 size를 확인을 완료한 상태입니다. (아래 confirm 사진) 여기서 이상한게 액체에서 키우면  cell 상태가 좋지 못하고 plasmid도 unstable해 지는것 같습니다.   셔틀백터를 처음 다뤄서 그러는데 제가 알지못하는 이유가 있는걸까요?    
회원작성글 오월준  |  03.14
Q. HPLC negative peak에 대해서 질문 드립니다!!
지금 MMS를 찍으면서 검량선을 만들고 있는데 Rep1~4 까지는 12분대에서 negative peak가 하나 있었는데 농도가 낮은(0.015625ppm) Rep5에서 negative peak가 정방향으로 역전 되서 나오네요. 전에 같은 농도의 다른 실험에서는 이런 일이 없었는데 갑자기 왜 그러는지 모르겠네요 ㅠㅠ
회원작성글 Bake Plum  |  03.13
Q. cloning 후 사이즈 확인 colony PCR에 대한 질문입니다. 첨부파일
안녕하세요 석사 학위과정 중인 학생입니다. 최근 cloning을 한 후 cloning이 잘 되었는지 사이즈 컨펌 colony PCR을 하는데 사진과 같이 DNA가 comb에 걸려 내려오지 않습니다.  colony PCR 시, colony를 아주 소량 따서 PCR 하였으며 annealing Tm과 extension time 모두 적절하게 하였습니다.  colony PCR이 되지 않아 LB broth에 접종하여 16h culture 후 LB O/N cell 200ul cell down하여 PBS 200ul으로 washing 후 DW 20ul으로 suspension 후 95도 5분 boiling한 sample을 template로 동일한 조건으로 PCR을 하여도 comb에 DNA가 걸립니다. 전기영동은 1% agarose에서 하였습니다.   1. comb에 PCR product가 걸린 것은 PCR product인가요? 아니면 colony로 넣은 template가 걸린것 인가요?   2. 이 경우 size confirm하기 위해 plasmid를 prep 후 plasmid를 template로 하거나 enzyme cut하여 cloning 여부를 확인할 수 있나요?      
회원작성글 Woneee  |  03.13
Q. 토끼마취 케타민+럼푼 비율 질문드립니다.
안녕하세요.    토끼 마취 관련 질문드립니다.   두개골 이식재 식립 관련 실험이고 마취시간은 1시간 정도로 생각하고 있습니다.   케타민+럼푼 조합으로 마취를 진행해야 하는데    찾아보니 0.7mL/kg 케타민에 럼푼 1:1 비율로 mix 하라는 글도 보이고, 케타민:럼푼 비율을 4:1 정도로 하라는 글도 보입니다..   경험이 있으신 실험경험자 분께서는 용량 및 비율 조언 주시면 정말   감사드리겠습니다..  
회원작성글 Deus  |  03.13
Q. 고형분 함량으로 농도 계산
안녕하세요 홍삼농축액을 샘플로하여 활성실험을 진행하기에 앞서 농축액의 농도를 알고자 고형분 측정을 진행하였습니다.  그 결과, 고형분 64%, 수분 36%로 측정되었는데 이 결과로 어떻게 농도를 계산할 수 있나요?? 
회원작성글 dmsghktn33..  |  03.13
Q. SDS-PAGE 마커 사라짐
안녕하세요 초보 연구자입니다. SDS PAGE 전기영동시 마커가 사라집니다. 분명히 홈에 마커를 분주했고 아래로 끌려 내려가는 것까지 확인했는데... 흔적도 없이 증발했습니다. 샘플은 안걸었었고 마커만 각각 다른종류로 3종류를 걸었습니다. 근데 사라졌어요;;; 3개다요 ㅋㅋㅋㅋ 전기 영동시간은 총 1시간 20분정도 됩니다. 겨우 겔만드는거 익혔나 했더니 이번엔 마커가 사라졌습니다. 너무 허탈합니다ㅋㅋㅋ 박사님도 이런적은 처음이라고 하시고.. 이유가 뭘까요?
회원작성글 욕구불만  |  03.13
Q. western blot 시 skim milk 증류수에 녹이면?
안녕하세요, western blot 시 생각없이 1차 항체 처리과정까지의 skim milk를 3차 증류수에 녹여서 사용했네요,,, 아직 디벨롭을 안해서 결과를 모르는데 망한건가요? 어떻게될까요,,,
회원작성글 서리태콩물  |  03.13
Q. 단백질 동결/감압건조 질문
안녕하세요, 과기인 여러분들께 도움을 받고자 질문을 등록합니다.   단백질 최종 DP를 동결건조 혹은 감압건조를 통해 분말형태로 만들어 보관합니다.   이 때, 분말 형태의 단백질을 다시 버퍼에 재구성하여 활성도를 살펴보면 일부 감소하는 경향을 나타납니다.   감소하는 경향을 왠지 2가지 부류로 유추되는데,   1. 동결 또는 감압 건조 시의 단백질 손실   2. 동결 또는 감압 건조에 의한 단백질 활성 부위 변화로 유추 됩니다.   혹시 이에 따라 경험적인 방향에서의 이유나 혹은 추천해주실만한 논문이 있으시면 감사하겠습니다.   즐거운 하루 되십시오.
회원작성글 흑야화  |  03.13
Q. Mammalian Codon optimize
저는 구조생물학 연구실에서 일하고 있는 대학원생입니다. Expi293F cell(mammalian cell)에서 protein을 발현하고자 하여 Cloning 단계에 있습니다. 단백질 - thromin cleavage site - 6x His tag 이런 식으로 cloning하고자 합니다. Mammalian cell에서 발현하기 위해서 codon optimization을 진행하고자 하는데 thrombin cleavage site도 codon optimize를 따로 진행해야하는지 궁금해서 질문남깁니다.
회원작성글 까까먹는까막눈  |  03.13
Q. competent cell 제조
구입한 competent cell를 불려서 stock를 만들고 싶은데, 불려서 stock 제조 방법을 아래와 같이 하면 될까요?  1. LB broth배지(without Antibiotic) 5ml에 구입한 competent cell  접종 하여 O/N 배양 2. 밤새 배양한 배양액 1/100 부피로 100ml LB broth 배지를 접종하고, OD600 = 0.5 - 0.6으로 될 때 까지 배양. 3. 세포를 멸균된 50ml falcon 튜브 2개에 옮기고 얼음 위에서 20분 동안 배양. 4. 4500 rpm 및 4°C(미리 냉각 원심분리기)에서 5분 동안 원심분리기를 하고 상층액을 폐기 5. 차가운 100mM CaCl2 20ml에 각 펠릿을 조심스럽게 현탁하고 얼음 위에서 1시간 동안 배양 6. 4500 rpm 및 4°C (미리 냉각 원심분리기)에서 5분 동안 원심분리기를 하고 상층액 폐기. 7. 차가운 15% 글리세롤이 함유된 85mM CaCl2 2ml을 얼음에 두고 펠릿을 조심스럽게 현탁 한다. 8. 50 - 200µl를 넣고 -80°C에서 보관. ***위 프로토콜에서, 구입한 cell를 불리기 위해 LB에서 키울 땐, 항생제를 첨가 하지 않고 키우나요? 만약,  첨가하여야 한다면, 어떤 항생제든 상관이 없나요? ***100mM CaCl2는 DW에 녹이나요? (글리세롤 첨가 안해도 되나요?)
회원작성글 dhehfl  |  03.13
Q. PM 테스트를 위한 시설을 가진 연구실이 있나요? (phenotype microarray test)
나는 나의 박테리아에 대한 PM 테스트를 원합니다. PM 테스트 시설이 있는 연구소는 저에게 연락해주세요. 제가 할 수 있는 연구실을 아는 사람이 있으면 알려주세요.  
회원작성글 kira  |  03.13
Q. sample stock 제조 계산식을 모르겠습니다 ㅠㅠ
Arjunic Acid, 1 mg을 활용하여 10 mM의 stock을 제조하려고 하는데요. 몇 mL의 DMSO에 녹여야 하는지 알려주세요 ㅠㅠ
회원작성글 융식  |  03.13
Q. HPLC 문제 질문 드립니다.
HPLC 기기는 Jasco 사를 사용중이고 크로마토 조건 이동상 ACN : H2O = 45 : 55 유속 1.5 ml/min 컬럼온도 35도   시료는 Acetaminophen, Caffeine, Methyl p-hydroxybenzoate, Propyl p-hydroxybenzoate 를 사용했고, MeOH에 시료를 녹이고 30분간 초음파 처리 후 분석을 진행했습니다. Acetaminophen을 제외하고 정상적인 피크가 보이는데 Acetaminophen만 peak fronting이 발생했는데 이유를 알 수 있을까요? 첫번째 peak가 Acetaminophen입니다. 학부생 연구 동아리로 분석을 진행하고 있는데 정보를 얻는 것이 한정적이여서 여기에 질문드립니다.   
회원작성글 연람  |  03.13
Q. 항암제 키트
혹시 항암제 키트 또는 세트를 판매하는 곳도 있나요? GBM 실험을 위해 항암제를 구하고 있는데 교수님께서 항암제 세트?를 본 적이 있다고 하셔서요..
회원작성글 별헤는밥  |  03.13
이전  01 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고