[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
신테카바이오
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioLab 장재봉 교수
전체보기 안전점검 LABox
 카테고리: 전체
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. VLC 농축이 안되는이유
VLC를 해서 분획물을 분리해서 V1에서 V31까지 얻었습니다. 근데 이 분리된 물질을 농축을 하려니까 나머지는 다 잘농축이 되었는데 V20부터 V22번까지가 농축이 되다가 어느정도가 한계인것같이 액체가 좀 남은상태로 계속 농축이 안되네요.. 5g을 분리했는데 분리농축된 물질들의 무게를 다더하면 농축안되는 애들때문에 5g이 훨씬 넘습니다..... 왜 농축이 안되는걸까요...
회원작성글 피븃  |  01.31
Q. 분자량으로 stock solution 만드는 법
분자량은 460인 powder를 DW에 녹여 100mM의 stock solution을 1mL 만들려고 한다면 얼마의 powder를 DW 1mL에 넣어야하나요?
회원작성글 SoliDeo  |  01.31
Q. column chromatography
column chromatography를 진행 중이고, 고정상은 실리카입니다. 샘플 물질에 금속이 붙어 있고 분자량이 크며 8개의 Cl이 달려 있어 잘 내려오지 않는 상황입니다. 이 때, 이동상으로 DCM(100%)이나, DCM에 Methanol을 소량 섞어 이용하였을 경우에는 매우 천천히 내려오기는 하지만 컬럼 전체에 끌리면서 내려옵니다. Ethyl acetate나 Methnol을 100%로 사용하는 경우에는 아예 내려오지 않습니다... 아래부터 질문입니다. 1. 위와 같은 경우에는 이동상의 극성이 문제가 아닌 것 같은데, 용해도 때문이라고 볼 수 있을까요? 2. 용해도가 원인일 경우, THF나 Chloroform 등을 이동상으로 사용해보는 것도 도움이 될까요? 3. 분리하려는 샘플 물질에 Cl이 8개가 달려있는데, 물질에 Cl이 달려있으면 컬럼에서 끌려내려올 수 있다고 알고 있습니다. 이럴 경우 끌림을 개선할 수 있는 방안이 있을까요? 궁금한 것을 바로 적다보니 글이 두서없는 점 양해부탁드립니다...
회원작성글 국물자작  |  01.31
Q. 약물의 dialysis bag 통과 관련 질문 / DDS / in vitro (급해요 ㅠㅠ )
dexamethasone palmitate를 활용하여 in vitro release test를 진행하고 있습니다. 분자량은 630.87이며, release media는 1% tween 80 PBS (100mL) 입니다. dialysis bag method를 활용해 37ºC에서 100rpm으로 진행하고 있습니다. donor에는 동일한 release media에 dex-pal을 37ºC에서 1mg/mL로 녹인 후 0.2um PVDF로 filteration한 solution을 1mL 넣어주고 있으며, 100% solution 농도는 약 0.221mg/mL입니다. release media에 대한 dexamethasone palmitate의 용해도는 100mL 당 30mg정도로 상당히 높은 편이며 sink condition을 충족합니다.  사이즈를 계산한 결과 6-8 kD dialysis bag을 사용하여도 충분히 통과되어야 하는데, 분석 결과 24시간이 지난 후에도 약물이 전혀 방출되지 않고, 100 kD Float-A-Lyzer G2 dialysis tube 에서도 똑같은 진행해보았는데, 일주일 간 방치해 보았을 때에도 약물 방출이 전혀 되고 있지 않아 질문드립니다. 또한 tween80과 약물의 상호작용으로 인해 미셀을 형성할 지도 모른다는 가설이 있어 PBS에 EtOH를 10% 섞어 외상으로 두고 동일한 방법으로 실험을 진행하여 보았으나 결과는 동일했습니다.. ㅜ dialysis bag release 전문가 선생님들 ..! 혹시 이럴 때 어떤 방식으로 문제를 해결해야 할 지 도와주세요..!  
회원작성글 유미유미윰윰  |  01.31
Q. Deep freezer 샘플 이동
안녕하세요 저희가 있는 연구실에서 Deep freezer를 3~4일간 못 쓰게 될 예정인데 이 때 동안 보관할 수 있는 업체나 장소가 있을 까요?
회원작성글 nssok789  |  01.31
Q. qPCR시 tamra pimer를 sybr green에 혼용해서 사용해도 되나요?
안녕하세요.  qPCR을 primer를 논문에서 찾아봤는데 tamra primer를 사용한 논문을 찾았습니다.  protien F,R primer서열 + FAM-5’ TTCCGGGATGCCGCTGCAAAG3’-TAMRA 알려주었는데 저희 랩은 sybr green을 사용해서 protein F,R서열만 가져와서 qPCR을 해도 괜찮을 거라고 생각이되는데 혹시 안되나요?? 서열 길이를 다 확인해본 결과 70-100bp내외였습니다.   추가적으로 sybr green으로 qPCR을 진행 할 경우 100-200bp내외로 primer을 구상한다고 하던데 250bp정도로 길어지면 문제가 발생 할까요?
회원작성글 규쟁  |  01.31
Q. cell morphology 관련 질문 드립니다. 첨부파일
cell line은 HaCaT 이고, 1XPBS로 washing 후, media(DMEM) change 직후 사진입니다. RNA isolation 을 진행하기 위해 12-well plate에 seeding 해 둔 상황인데, media change 하기 직전까지는 괜찮았던 cell이 저렇게 되니 당황스럽네요ㅠㅠ 왼쪽 부분이 제가 평소에 아는 HaCaT morphology이고, 오른쪽 부분은 마치 cell이 터진 것처럼 물방울이 cell 주위에 형성된 저는 처음 보는 비정상적인 모습입니다. 혹시 이런 비슷한 경우를 경험하신 분이 있나요? 있으시다면 원인이 무엇인가요?ㅠㅠ 나름 HaCaT cell culture를 컨탐 없이 해왔어서, 원인을 정확히 모르겠습니다ㅠ
회원작성글 shinhwa  |  01.31
Q. 세포주 가능한 계대배양 횟수 확인방법
한국세포주은행에서 세포주를 검색하면 passage number까지 알 수 있다고 들었는데 culture method와 culture morphology까지만 보입니다.. 미천한 학부생에게 가르침을 주십시오
회원작성글 앞구르기  |  01.31
Q. SDS 전기 영동 시 기계의 문제로 밴드가 흐리게 나올 수도 있나요?
안녕하세요, 이제 갓 랩실에 들어온 예비 석사생입니다. 이번에 계속해서 SDS 전기 영동을 하고 있는데 밴드가 계속 흐리게 나와서 질문드립니다. 분명 같은 시료를 다른 농도로, 처음에는 750ug/ml 이번에는 1mg/ml로 희석하여 실시 하였는데 처음에는 밴드가 선명하게 나왔지만 이번에는 잘 나오지 않았습니다. 결국에는 마지막에 와서 기계가 망가졌는데 혹시 기계 문제로 밴드가 흐리게 나오거나 아예 안 나올 수가 있나요?
회원작성글 jeansflow  |  01.31
Q. 초음파분쇄기 없으면 다른수단 있을까요
물질을 용해시키려고 데이타시트를 보니 용매를 넣고 ultrasonic 초음파 분쇄하라고 되있는데요 현 위치에 기자재가 없습니다. 볼택싱을 1분이상 했는데도 안되네요ㅠㅠ 청소용? 소니케이터(워터배스모양)는 있는데요 거기에 튜브를 담그어 볼까요? 아님 다른 방법이 있을까요?
회원작성글 pretty  |  01.31
Q. Gibco사 cell freezing media 사용하시는 분들 질문있습니다.
안녕하세요.    cell stock 배지로 이번에 처음 Gibco 사의 Cell freezing medium을 구입하였습니다. (Cat# 12648010)   이전에 lonza 회사꺼를 썼는데 단종되서.. 바꿔보았는데요.    이전 사용했던 것과는 다르게 이건 보관온도가 -20도 이고 사용할 때 4도에서 thawing하여 사용하라고 하더라구요.   그런데 할 때마다 녹이기 번거로울것 같아서 혹시 4도에 계속 보관해도 되는지 질문드립니다. 
회원작성글 LMC  |  01.31
Q. 실험디자인이 이해가 잘 안되는데... 설명좀 부탁드립니다.
동물시험 논문 디자인이 잘 이해가 안되서 질문 드려요.. 해당 논문의 실험군은 시험물질을 15일간 섭취하다가 질병을 유발하고 추가로 1, 3일을 더 섭취 했구요, 대조군은 시험물질을 15일간 섭취하고 질병을 유발하지 않고 1, 3일을 더 섭취했습니다. 바이오마커는 면역관련 사이토카인이구요.. 이 논문에서는 왜 실험군 대조군 모두 시험물질을 섭취하는 디자인으로 만든건지 이유가 궁금합니다. 예방 효과?를 보려고 한 걸까요? 제가 그동안 봐온 논문은 시험물질을 먹거나 안먹거나로 실험군, 대조군을 나누는 것만 봤는데 해당 논문의 의미를 잘 모르겠습니다. 추가로 이 논문과 동일하게 수행되었으면서 동일한 사람이 쓴 선행논문이 있습니다. 그 논문은 시험군에 질병유발하고 1,3,5,7,15일을 면역지표를 보았고, 대조군은 아무것도 안하고 1,3,5,7,15일을 면역지표를 보았습니다. 이렇게 따로따로 논문을 내면 두 논문사이에 통계처리가 안되서 두 논문을 비교하는게 무슨 의미가 있을지 약간 의아합니다.  후행논문에서 선행논문과 비교하여 봤을때 시험물질의 섭취는 면역을 조절한다고 언급하더라구요. 이렇게 비교할 거였으면 왜 한 논문에 싣지않고 따로따로 출간한 걸까요...(?)   제가 질문드린 논문은 International Journal of Molecular Science에 발간되었고 선행논문은 Journal of Clinical Medicine에 발간되었습니다.  논문 수 늘리려고? 일까요?   아시는분 답변 부탁드려요....
회원작성글 Tathion  |  01.31
Q. LC mobile phase 용매 만드는 법
Acetonitrile:water(20 mmol NH4HCO3, NH4•H2O adjust pH to 8.3) = 60:40 (v/v/) 라고 써있는데 그러면 만드는 방법이 둘 중 어떤건지 궁금합니다. 1. ACN:Water를 60:40으로 섞은 용매에 NH4HCO3를 20mmol 맞춰 g 넣고 nh4로 ph를 8.3까지 맞춘다. 2. Water 1L에 NH4HCO3를 20mmol 맞춰 g 넣고 nh4로 ph를 8.3까지 맞춘 후 ACN 60 ml와 앞서 만든 water 용매 40 ml를 넣는다. 둘 중 어느게 맞을까요??
회원작성글 Heeeeee7  |  01.31
Q. Gluconacetobacter xylinus 배양 시 OD 값이 안 올라가는 문제...
Gluconacetobacter xylinus 를 키우고 있는데, 논문들을 찾아서 여러가지 배지조성으로 키워봐도 OD값이 전혀 안올라가고 있습니다. Cellulose 를 생성하는 균주라 접종 후 7일정도 되면 배양액 위로 두꺼운 막 형태의 cellulose gel 이 형성되는 것이 관찰되고 agar 배지에 도말해봐도 colony 가 나타나는 것으로 보아 균이 자라기는 하는 것 같은데, 논문들에서는 배양 시 균체 증식에 따라 OD 값이 증가한다고 되어 있는데 동일한 형태로 자라지 않아 pilot scale 진행을 못하고 있습니다. 배지조성이 문제인지, 다른 문제가 있을지 조언 부탁 드립니다.
회원작성글 둘둘  |  01.31
Q. WB 항체 제작 관련해서 질문드립니다
안녕하세요   WB을 통해서 특정 protein의 발현을 확인하려고 실험중인 대학원생입니다   시판중인 WB용 antibody를 이용해서 WB을 진행하니 결과가 제대로 나오지 않아서 antibody를 제작해서 진행해보려고 생각중입니다 (기존 논문들에서는 이 protein을 WB으로 발현확인하는 경우가 거의 없더라구요)   이와 관련해서 검색을 좀 해보니, 잘된다는 분들도 있고, 안된다고하시는 분들도 있어서, 진행 경험이 있으신 분들께 조언을 얻고자 질문드립니다     감사합니다!  
회원작성글 몽유병  |  01.31
Q. cell divide
안녕하세요. cell 실험을 하는 학생입니다. 현재 cell을 계속 키우고 있는 상태 (stock으로부터 계대는 2번 한 상태) 입니다. 제가 궁금한점은. (seeding할 용도) 100파이의 한 플레이트를 12개정도로 divide해도 상관 없는건가요? (passage num을 낮추기 위해서요) 또 stock으로부터 꺼내진 cell을 몇번 정도 계대를 해주어야 seeding 이 가능한건지 알고싶습니다
회원작성글 똑똑해지자  |  01.31
Q. 마우스 종양 생성 후 피하투여 관련 질문드립니다.
안녕하세요. 동물실험에 대해 공부하고 있는 대학생입니다.    대부분 논문에서 누드 마우스에 cancer cell을 피하투여해서 종양을 만들어 성장 시킨후, 약물을 투여합니다.    그런데, 이 약물을 투여할 때 피하투여 방식을 사용하게 되면 종양과 사이의 거리에 따라 약물이 작용하는 정도가 달라진다고 생각되는데, 대부분의 논문에서는 단지, 피하투여를 사용하였다. 이런 말만 쓰여 있어서 질문 드립니다.  약물을 피하투여 할 때, 대부분 어떤 방식으로 피하투여 위치를 정하시는지 궁금합니다..  관련 논문이나 참고할 만한 논문도 공유 부탁드립니다!! 감사합니다. 
회원작성글 익명09  |  01.31
Q. 몰수 계산 (초보) 제발 도와주세요
85% phosphoric acid 가 있는데 질량은 98g/mol입니다. 볼륨은 15ml있습니다 85%가 몇 M인지 알 수 있을까요? 어떻게 계산하는지 알려주실 수 있으나요?
회원작성글 yyyyyy  |  01.30
Q. 35% CaCl2 밀도 구하기 입니다..
0.1M 35% CaCl2의 몰농도를 구해야하는데요 ㅜ 몰수는 0.32mol, 용액의 l수를 구하고 몰농도를 구해야하는데 35% CaCl2의 밀도를 몰라서 중간과정에서 막히고 있습니다.....
회원작성글 으엥  |  01.30
Q. dilution refolding 테크닉
protein folding에서 dilution refolding 방법을 사용하려고 하는데요. 그 중에서도 pulsed dilution으로 20-fold refolding buffer에 denatured protein sample을 일정량 피펫으로 넣고, stirring 하면서 일정시간후에 다시 넣는 방법을 채택하고 있습니다. 그런데 protocol을 검색해 봐도 예시로 100ul 넣고 1min 기다리는 식으로 넣는다, 이런 식으로는 나와있지 않더라고요. 이미 졸업한 선배가 진행한 실험을 재진행하는 중이라 조언을 구할 선배가 없습니다ㅠ 1) denature protein sample을 refolding buffer에 넣는 양과 기다리는 시간은 어떻게 정하나요? 2) 피펫으로 protein sample을 넣을 때 팁을 refolding buffer 안에 넣은 후 조금씩 돌리면서 분사한다거나, 아니면 그냥 한번에 분사하거나, 위에서 방울방울 떨어뜨리거나 방법의 차이에 따라 유의미한 차이가 있을까요?
회원작성글 미틈틈  |  01.30
이전  01 02 03 4 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고