[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
서린바이오사이언스
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
피부 마이크로바이옴 연구 동향
전체보기 안전점검 LABox
 카테고리: 전체
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. qPCR시 tamra pimer를 sybr green에 혼용해서 사용해도 되나요?
안녕하세요.  qPCR을 primer를 논문에서 찾아봤는데 tamra primer를 사용한 논문을 찾았습니다.  protien F,R primer서열 + FAM-5’ TTCCGGGATGCCGCTGCAAAG3’-TAMRA 알려주었는데 저희 랩은 sybr green을 사용해서 protein F,R서열만 가져와서 qPCR을 해도 괜찮을 거라고 생각이되는데 혹시 안되나요?? 서열 길이를 다 확인해본 결과 70-100bp내외였습니다.   추가적으로 sybr green으로 qPCR을 진행 할 경우 100-200bp내외로 primer을 구상한다고 하던데 250bp정도로 길어지면 문제가 발생 할까요?
회원작성글 규쟁  |  01.31
Q. cell morphology 관련 질문 드립니다. 첨부파일
cell line은 HaCaT 이고, 1XPBS로 washing 후, media(DMEM) change 직후 사진입니다. RNA isolation 을 진행하기 위해 12-well plate에 seeding 해 둔 상황인데, media change 하기 직전까지는 괜찮았던 cell이 저렇게 되니 당황스럽네요ㅠㅠ 왼쪽 부분이 제가 평소에 아는 HaCaT morphology이고, 오른쪽 부분은 마치 cell이 터진 것처럼 물방울이 cell 주위에 형성된 저는 처음 보는 비정상적인 모습입니다. 혹시 이런 비슷한 경우를 경험하신 분이 있나요? 있으시다면 원인이 무엇인가요?ㅠㅠ 나름 HaCaT cell culture를 컨탐 없이 해왔어서, 원인을 정확히 모르겠습니다ㅠ
회원작성글 shinhwa  |  01.31
Q. 세포주 가능한 계대배양 횟수 확인방법
한국세포주은행에서 세포주를 검색하면 passage number까지 알 수 있다고 들었는데 culture method와 culture morphology까지만 보입니다.. 미천한 학부생에게 가르침을 주십시오
회원작성글 앞구르기  |  01.31
Q. SDS 전기 영동 시 기계의 문제로 밴드가 흐리게 나올 수도 있나요?
안녕하세요, 이제 갓 랩실에 들어온 예비 석사생입니다. 이번에 계속해서 SDS 전기 영동을 하고 있는데 밴드가 계속 흐리게 나와서 질문드립니다. 분명 같은 시료를 다른 농도로, 처음에는 750ug/ml 이번에는 1mg/ml로 희석하여 실시 하였는데 처음에는 밴드가 선명하게 나왔지만 이번에는 잘 나오지 않았습니다. 결국에는 마지막에 와서 기계가 망가졌는데 혹시 기계 문제로 밴드가 흐리게 나오거나 아예 안 나올 수가 있나요?
회원작성글 jeansflow  |  01.31
Q. 초음파분쇄기 없으면 다른수단 있을까요
물질을 용해시키려고 데이타시트를 보니 용매를 넣고 ultrasonic 초음파 분쇄하라고 되있는데요 현 위치에 기자재가 없습니다. 볼택싱을 1분이상 했는데도 안되네요ㅠㅠ 청소용? 소니케이터(워터배스모양)는 있는데요 거기에 튜브를 담그어 볼까요? 아님 다른 방법이 있을까요?
회원작성글 pretty  |  01.31
Q. Gibco사 cell freezing media 사용하시는 분들 질문있습니다.
안녕하세요.    cell stock 배지로 이번에 처음 Gibco 사의 Cell freezing medium을 구입하였습니다. (Cat# 12648010)   이전에 lonza 회사꺼를 썼는데 단종되서.. 바꿔보았는데요.    이전 사용했던 것과는 다르게 이건 보관온도가 -20도 이고 사용할 때 4도에서 thawing하여 사용하라고 하더라구요.   그런데 할 때마다 녹이기 번거로울것 같아서 혹시 4도에 계속 보관해도 되는지 질문드립니다. 
회원작성글 LMC  |  01.31
Q. 실험디자인이 이해가 잘 안되는데... 설명좀 부탁드립니다.
동물시험 논문 디자인이 잘 이해가 안되서 질문 드려요.. 해당 논문의 실험군은 시험물질을 15일간 섭취하다가 질병을 유발하고 추가로 1, 3일을 더 섭취 했구요, 대조군은 시험물질을 15일간 섭취하고 질병을 유발하지 않고 1, 3일을 더 섭취했습니다. 바이오마커는 면역관련 사이토카인이구요.. 이 논문에서는 왜 실험군 대조군 모두 시험물질을 섭취하는 디자인으로 만든건지 이유가 궁금합니다. 예방 효과?를 보려고 한 걸까요? 제가 그동안 봐온 논문은 시험물질을 먹거나 안먹거나로 실험군, 대조군을 나누는 것만 봤는데 해당 논문의 의미를 잘 모르겠습니다. 추가로 이 논문과 동일하게 수행되었으면서 동일한 사람이 쓴 선행논문이 있습니다. 그 논문은 시험군에 질병유발하고 1,3,5,7,15일을 면역지표를 보았고, 대조군은 아무것도 안하고 1,3,5,7,15일을 면역지표를 보았습니다. 이렇게 따로따로 논문을 내면 두 논문사이에 통계처리가 안되서 두 논문을 비교하는게 무슨 의미가 있을지 약간 의아합니다.  후행논문에서 선행논문과 비교하여 봤을때 시험물질의 섭취는 면역을 조절한다고 언급하더라구요. 이렇게 비교할 거였으면 왜 한 논문에 싣지않고 따로따로 출간한 걸까요...(?)   제가 질문드린 논문은 International Journal of Molecular Science에 발간되었고 선행논문은 Journal of Clinical Medicine에 발간되었습니다.  논문 수 늘리려고? 일까요?   아시는분 답변 부탁드려요....
회원작성글 Tathion  |  01.31
Q. LC mobile phase 용매 만드는 법
Acetonitrile:water(20 mmol NH4HCO3, NH4•H2O adjust pH to 8.3) = 60:40 (v/v/) 라고 써있는데 그러면 만드는 방법이 둘 중 어떤건지 궁금합니다. 1. ACN:Water를 60:40으로 섞은 용매에 NH4HCO3를 20mmol 맞춰 g 넣고 nh4로 ph를 8.3까지 맞춘다. 2. Water 1L에 NH4HCO3를 20mmol 맞춰 g 넣고 nh4로 ph를 8.3까지 맞춘 후 ACN 60 ml와 앞서 만든 water 용매 40 ml를 넣는다. 둘 중 어느게 맞을까요??
회원작성글 Heeeeee7  |  01.31
Q. Gluconacetobacter xylinus 배양 시 OD 값이 안 올라가는 문제...
Gluconacetobacter xylinus 를 키우고 있는데, 논문들을 찾아서 여러가지 배지조성으로 키워봐도 OD값이 전혀 안올라가고 있습니다. Cellulose 를 생성하는 균주라 접종 후 7일정도 되면 배양액 위로 두꺼운 막 형태의 cellulose gel 이 형성되는 것이 관찰되고 agar 배지에 도말해봐도 colony 가 나타나는 것으로 보아 균이 자라기는 하는 것 같은데, 논문들에서는 배양 시 균체 증식에 따라 OD 값이 증가한다고 되어 있는데 동일한 형태로 자라지 않아 pilot scale 진행을 못하고 있습니다. 배지조성이 문제인지, 다른 문제가 있을지 조언 부탁 드립니다.
회원작성글 둘둘  |  01.31
Q. WB 항체 제작 관련해서 질문드립니다
안녕하세요   WB을 통해서 특정 protein의 발현을 확인하려고 실험중인 대학원생입니다   시판중인 WB용 antibody를 이용해서 WB을 진행하니 결과가 제대로 나오지 않아서 antibody를 제작해서 진행해보려고 생각중입니다 (기존 논문들에서는 이 protein을 WB으로 발현확인하는 경우가 거의 없더라구요)   이와 관련해서 검색을 좀 해보니, 잘된다는 분들도 있고, 안된다고하시는 분들도 있어서, 진행 경험이 있으신 분들께 조언을 얻고자 질문드립니다     감사합니다!  
회원작성글 몽유병  |  01.31
Q. cell divide
안녕하세요. cell 실험을 하는 학생입니다. 현재 cell을 계속 키우고 있는 상태 (stock으로부터 계대는 2번 한 상태) 입니다. 제가 궁금한점은. (seeding할 용도) 100파이의 한 플레이트를 12개정도로 divide해도 상관 없는건가요? (passage num을 낮추기 위해서요) 또 stock으로부터 꺼내진 cell을 몇번 정도 계대를 해주어야 seeding 이 가능한건지 알고싶습니다
회원작성글 똑똑해지자  |  01.31
Q. 마우스 종양 생성 후 피하투여 관련 질문드립니다.
안녕하세요. 동물실험에 대해 공부하고 있는 대학생입니다.    대부분 논문에서 누드 마우스에 cancer cell을 피하투여해서 종양을 만들어 성장 시킨후, 약물을 투여합니다.    그런데, 이 약물을 투여할 때 피하투여 방식을 사용하게 되면 종양과 사이의 거리에 따라 약물이 작용하는 정도가 달라진다고 생각되는데, 대부분의 논문에서는 단지, 피하투여를 사용하였다. 이런 말만 쓰여 있어서 질문 드립니다.  약물을 피하투여 할 때, 대부분 어떤 방식으로 피하투여 위치를 정하시는지 궁금합니다..  관련 논문이나 참고할 만한 논문도 공유 부탁드립니다!! 감사합니다. 
회원작성글 익명09  |  01.31
Q. 몰수 계산 (초보) 제발 도와주세요
85% phosphoric acid 가 있는데 질량은 98g/mol입니다. 볼륨은 15ml있습니다 85%가 몇 M인지 알 수 있을까요? 어떻게 계산하는지 알려주실 수 있으나요?
회원작성글 yyyyyy  |  01.30
Q. 35% CaCl2 밀도 구하기 입니다..
0.1M 35% CaCl2의 몰농도를 구해야하는데요 ㅜ 몰수는 0.32mol, 용액의 l수를 구하고 몰농도를 구해야하는데 35% CaCl2의 밀도를 몰라서 중간과정에서 막히고 있습니다.....
회원작성글 으엥  |  01.30
Q. dilution refolding 테크닉
protein folding에서 dilution refolding 방법을 사용하려고 하는데요. 그 중에서도 pulsed dilution으로 20-fold refolding buffer에 denatured protein sample을 일정량 피펫으로 넣고, stirring 하면서 일정시간후에 다시 넣는 방법을 채택하고 있습니다. 그런데 protocol을 검색해 봐도 예시로 100ul 넣고 1min 기다리는 식으로 넣는다, 이런 식으로는 나와있지 않더라고요. 이미 졸업한 선배가 진행한 실험을 재진행하는 중이라 조언을 구할 선배가 없습니다ㅠ 1) denature protein sample을 refolding buffer에 넣는 양과 기다리는 시간은 어떻게 정하나요? 2) 피펫으로 protein sample을 넣을 때 팁을 refolding buffer 안에 넣은 후 조금씩 돌리면서 분사한다거나, 아니면 그냥 한번에 분사하거나, 위에서 방울방울 떨어뜨리거나 방법의 차이에 따라 유의미한 차이가 있을까요?
회원작성글 미틈틈  |  01.30
Q. 전기영동 사진 분석 첨부파일
안녕하세요 이제 막 랩실에 들어와서 연구실 생활을 하고있는 학부생입니다!  DNA purification 후 얻은 dna로 전기영동을 진행하던 중 질문이 있어서 사진과 함께 질문 드립니다!   Q1. 주황색 박스 안에 있는 밴드는 왜 휘어져있는것인지 궁금합니다! 전기영동 진행 중 책상에 큰 충격은 없었습니다. Q2. 파란 작스 안에 있는 밴드들은 대체로 밑부분이 옴폭 들어가있는데 이같은 개형은 왜 발생되는지 궁금합니다. Q3. 자주색 박스와 초록색 박스안에 밴드가 끝부분에서 두개씩 있는걸 볼 수 있는데 자주색 박스의 반 갈라짐과 초록색 박스의 반 갈라짐이 조금 다른 모습을 보이는데 밴드가 끝부분에서 반으로 갈라지는 이유와 갈라지는 모양이 조금씩 다른 이유가 궁금합니다.   제가 이론이 조금 미숙하여 모르는 부분이 많습니다 알려주신다면 열심히 참고하여 공부하겠습니다, 감사합니다. 혹 전기영동과 관련된 추천 서적이 있다면 추천 부탁드립니다!
회원작성글 생명사냥꾼  |  01.30
이전  1 02 03 04 05 06 07 08 09 10  다음
공지사항
2022년 실험Q&A 우수회원 안내
중고등학생의 과학실험주제나 방법 및 숙제에 대한 질문 자제 요청
실험관련연재
세오 연재중실전 실험 프로토콜 101
세오 (필명) (Cincinnati Children’s Hospital Medical Center)
곽민준 연재중랩노트
곽민준 (POSTECH 생명과학과)
신코 연재중분석장비 이야기
분석장비 탐험가 (필명) ((주)신코)
박은총 연재마감후배에게 주고 싶은 면역학 노트
박은총(Duke University)
Mr.S 연재마감의학계의 Spectaculum: 임상시험
Mr. S (필명) (연세대학교)
에스프리 연재마감실험을 해봅시다
에스프리 (필명)
이제욱 연재마감생명과학자 기초체력 다지기
이제욱 (오송첨단의료산업진흥재단, 신약개발지원센터)
금주의 인기Q&A
긴급!! mouse i.p injection 농도 문의 [1]
물질혼합 농도 및 용량 계산 (초보) [4]
Mixture를 만들때 농도에 따른 용량 [1]
계대배양 [1]
논문 그래프에서 *의 의미가 무엇인가요 [2]
HPLC 단당류 분석 [3]
TLC관련 문의!! 부탁드려요 [3]
몰수 계산 (초보) 제발 도와주세요 [2]
세포해동 [2]
특정 Colony만 plasmid yield가 낮게 나올 수도 있나요? [1]
최근답변자 우수답변자
대왕개구리SPEED

올챙이pretty

올챙이버그기

개구리CBD 김선..

개구리범수리

뒷다리에효효

개구리clickclick

알민드

꽃개구리juno

꽃개구리착한사람

꽃개구리visavis

꽃개구리느림보

개구리Q.E.D.

개구리냥냥아빠

개구리flu...

개구리Marine

위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
엘앤씨바이오 광고